taxonID	type	description	language	source
E41687B47E4CFFA49E1EFA32FA3EF8D1.taxon	materials_examined	Type species: Parasabella media Bush, 1905 (see Read, 2010, contrary to Tovar-Hernández & Harris, 2010).	en	Capa, María, Murray, Anna (2015): Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range. Zoological Journal of the Linnean Society 175 (4): 764-811, DOI: 10.1111/zoj.12308, URL: http://dx.doi.org/10.1111/zoj.12308
E41687B47E49FFBD9E27F967FAE9FA08.taxon	description	2010: 14. Holotype: ZMUC – POL – 2115, Little Barrier Island, New Zealand, 55 m depth, 29. xii. 1914, Dr Th. Mortensen Pacific Expedition. Additional material examined (see Appendix for details): Western Australia: Bunbury (one); Ningaloo reef (three); Northern Territory: Darwin Harbour (one); Queensland: Lizard Island (three); New South Wales: Coffs Harbour (one), Port Stephens (eight), Newcastle (four), Malabar (one), Botany Bay (12), Port Kembla (one), Bass Point (one), Jervis Bay (two), Ulladulla (two), Tathra (three), Batemans Bay (one), Point Upright (one), Eden (eight), Twofold Bay (eight); South Australia: Kangaroo Island (nine), Port Hughes (two). Diagnosis: Stiff, fleshy swelling occupying dorsum of first two chaetigers, with transverse ridge and forming posterior-facing pocket (s), either continuous across dorsum or separated by faecal groove (synapomorphy for this species complex). Radiolar eyes absent. Radioles supported basally by 14 – 20 rows of vacuolated cells in cross-section. Thoracic ventral shields in contact with neuropodial tori. Inferior thoracic notochaetae broadly hooded, of type B; hoods 1.5 times the width of shaft, and as long as four to five times maximum width. Thoracic uncini with medium-length handles. Description of Australian specimens: 2.3 to 35 mm long, 0.5 to 3 mm wide, 5 – 8 thoracic chaetigers, 20 to> 60 abdominal chaetigers. Radiolar crown with long basal lobes (∼ two thoracic segments), radioles arranged in two semicircles, curling inward in larger specimens. Six to 14 pairs of radioles, each supported basally by 14 – 20 rows of vacuolated cells in cross-section (Fig. 4 A). Radioles with wide, tapering tips, bare for the length of two thoracic segments. Radiolar flanges and eyes absent. Dorsal lips with radiolar appendages as long as 4 – 6 thoracic segments; 0 – 2 dorsal pinnular appendages. Posterior peristomial ring collar of even length all way round (Figs 6 B, 7 A, B) or oblique laterally (Fig. 7 C), reaching junction of crown and thorax (Figs 6 A, 7 C), with midventral incision and broad ventral lappets with rounded anterior margins (Figs 6 C, 7 A); dorsal margins subquadrate (Figs 6 D – F, 7 D, E). Peristomial eyes shallowly embedded under base of radiolar crown. Fleshy swelling with transverse ridge, occupying dorsum of first two chaetigers, forming either two posteriorfacing sinuses or pockets separated by faecal groove (Figs 6 D, E, 7 D), or continuous across faecal groove forming one large posterior-facing pocket (Figs 6 F, 7 E). Ventral glandular shields similar in width to each other, in contact with tori (Figs 6 B, C, 7 A); first ventral shield one to two times length of following, with anterior margin m-shaped (Fig. 6 C). Collar chaetae elongate, narrowly hooded (Fig. 7 F). Superior thoracic notochaetae elongate, narrowly hooded, inferior group with two rows of shorter broadly hooded chaetae of type B (Figs 2 C, 5 B, 6 G), with hoods as long as 4 – 5 times maximum width and maximum width 1.5 times width of shaft. Thoracic neuropodial tori slightly diminishing in width posteriorly (Figs 6 B, 7 A, B). Uncini with about 10 rows of similar-sized teeth above main fang, covering more than half length of main fang (Fig. 7 I, J), neck as long as breast, well-developed breast and medium-length handles (∼ 1.5 times distance from main fang to breast) (Fig. 5 J, K). Companion chaetae with enlarged subdistal end, conspicuous microtubercles forming hood, resulting in dentate appearance, with thin distal mucro compressed laterally (Fig. 7 K, L). Abdominal neuropodial chaetae narrowly hooded in both anterior and posteri- or rows (Fig. 7 M). Abdominal uncini with about 10 rows of similar-sized teeth above main fang covering more than half length of main fang (Fig. 7 N), neck shorter than breast, well-developed breast and short handles (0.5 times distance between breast and main fang, Fig. 5 L). Pygidium as rounded rim around ventral anus (Fig. 7 O), with scattered eyespots present on both sides, only visible in some specimens. Colour pattern: Brown pigmentation on bases of radioles and on groups of pigmented pinnules (Fig. 6 A, D) in some specimens. Scattered pigment spots present along longitudinal axis of radioles (Fig. 6 A, D). Some specimens with brown pigment on thorax, absent from ventral shields and tori (Fig. 6 A – C). Spots present between neuro- and notopodial rami, superficially resembling interramal eyespots (Fig. 6 B), faded in some specimens. Reproductive features: Gravid specimens with body lengths of 10 – 35 mm were found, with eggs in last thoracic and in abdominal segments. Genetic data: Sequences from two specimens from Western Australia and four from New South Wales show wide genetic variation, congruent with their geographical distribution, with the physically most distant specimens showing the largest genetic divergence (of up to 23.6 % in cox 1 and 10.2 % in ITS sequences). Genetic distance in cox 1 sequences to the other Parasabella species is 29.6 – 31.5 % (Table 3) and 20.9 – 28.4 % in ITS (Table 4). All members of this clade exclusively show the nucleotide sequence TGGA in positions 173 – 176 of the ITS alignment, amongst several scattered onenucleotide synapomorphies along the nuclear and mitochondrial fragments. Remarks: This species is easily distinguished from other congeners by the fleshy swellings on the dorsum of the first two chaetigers. Augener (1926: 247, fig. 18 A, B) illustrated this very distinctive feature in his original description. However, variations have been found amongst Australian specimens, as some show the swelling as a continuous transverse ridge with a single large posterior-facing sinus and without the faecal groove and cilia running longitudinally across this structure. The two morphological conditions (continuous, or dual dorsal swelling across anterior thoracic segments) are not congruent with the two subclades that show maximum genetic divergence. PS 26 (from New South Wales) is the only specimen included in the genetic analyses with a continuous transverse dorsal swelling whereas the rest of specimens (New South Wales and Western Australia) present the dual split structure across the dorsum.	en	Capa, María, Murray, Anna (2015): Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range. Zoological Journal of the Linnean Society 175 (4): 764-811, DOI: 10.1111/zoj.12308, URL: http://dx.doi.org/10.1111/zoj.12308
E41687B47E49FFBD9E27F967FAE9FA08.taxon	materials_examined	Type locality: Little Barrier Island, New Zealand, 55 m depth. Distribution: New Zealand, Australia (Queensland, New South Wales, South Australia, Western Australia; Fig. 1 A). Ecological notes: The species is widespread in New Zealand but usually occurs as single individuals on wharf piles (G. Read, pers. comm.). It was reported in New Zealand Port surveys from 2005 – 2008 (Inglis et al., 2005, 2006, 2008). In Australia, it has been recorded not only in the fouling communities from wharf piles in port areas (Port Kembla, Eden, Botany Bay and Bunbury Harbour, see Appendix), but has also been collected from more pristine coastal and offshore environments such as Lizard Island in Queensland, Kangaroo Island in South Australia, and south of Jervis Bay, New South Wales, from the intertidal to 80 m depth. In future, genetic studies of New Zealand populations should also be included to evaluate the broad distribution range reported for the species to determine if this can be explained through natural means or if unintentional translocations could be responsible for such a wide distribution (not detected in this study). PARASABELLA SP. CF. P. AULACONOTA (VON	en	Capa, María, Murray, Anna (2015): Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range. Zoological Journal of the Linnean Society 175 (4): 764-811, DOI: 10.1111/zoj.12308, URL: http://dx.doi.org/10.1111/zoj.12308
E41687B47E52FFB69E70FA70FDD8FB83.taxon	description	(FIGS 4 E, 5 E, R – T, 12, 13) Holotype: AM W. 47145, New South Wales, Shellharbour, north-east of Bass Point, ‘ The Humps’, 34 ° 35 ′ 35 ″ S, 150 ° 54 ′ 22 ″ E, from orange sponge, 22.4 m depth, 4. v. 2010, coll. R. T. Springthorpe, MI NSW 3956. Paratypes: AM W. 47146 (6), same collection details as holotype. Additional material examined (see Appendix for details): Australia. Western Australia: Esperance (three), Albany (four), Outer Bunbury Harbour (two), Ningaloo Reef (many), Dampier Archipelago (nine); Northern Territory: Darwin Harbour (two); Queensland: Weipa (six), Cairns (six); New South Wales: Cook Islands (four), Byron Bay (two), Solitary Islands (eight), Coffs Harbour (two), Port Stephens (11), Port Jackson (12), Botany Bay area (16, including PS 21, PS 23, PS 24, PS 28), Shellharbour (one = PS 03), Jervis Bay (one), Batemans Bay (six). USA. Hawaii: Oahu, Coconut Island (eight, including PS 10, PS 11, PS 12). Comparative material examined: Holotype of Demonax leucaspis Kinberg, 1867, SMNH 575, Peru, east of Lima, San Lorenzo Island, 12 ° 00 ′ S, 077 ° 00 ′ W, collected by Eugenie Expedition 1851 – 1853, station 568 – 9. Holotype of Sabella albicans Johansson, 1922, UPSZTY 2304, Japan, Misaki, ‘ Diver’ from Laminaria, S. Bock collection. Diagnosis: Radiolar eyes absent. Radioles supported by 6 – 10 rows of vacuolated cells near base. Thoracic ventral shields in contact with neuropodial tori. Inferior thoracic notochaetae type A, with hoods three times as wide as shaft, and up to three times as long as its maximum width. Thoracic uncini with mediumlength handles, and neck half of breast length. Description: Body 12.5 mm long, 1.7 mm wide; crown 4 mm long; Thorax with six chaetigers, and abdomen with 63, posterior end regenerating. Preserved holotype lacks colour on trunk, but diffuse brown pigmentation is present on collar, and crown has four pigment bands with radiolar pinnules also pigmented, as well as brown pigment spots groups of bars along radioles. Radiolar crown basal lobes as long as 1.5 times thoracic chaetigers, with nine pairs of radioles arranged in two semicircles. Radioles with outer margins quadrangular to round in cross-section (Fig. 13 A, D) and each supported basally by eight vacuolated cells (Fig. 4 E). Radiolar tips wide, tapering, bare for approximately twice length of longest pinnules (or equal to length of four thoracic segments). Radiolar flanges and eyes absent. Dorsal lips with radiolar appendages as long as five thoracic segments, each with single pinnular appendage. Posterior peristomial ring collar similar in length all around, completely covering base of crown, with rounded ventral lappets shorter than one thoracic segment (Fig. 13 A, B) and rounded dorsal margins. Peristomial eyes present subdermally. Anterodorsal fleshy swelling absent. Thoracic ventral shields similar in length, twice as wide as long, in contact with thoracic tori. First ventral shield with slight incision in anterior margin and m-shaped. Collar chaetae elongate, narrowly hooded (Fig. 13 E). Superior thoracic notochaetae elongate narrowly hooded (Fig. 13 F); inferior thoracic chaetae broadly hooded (type A), and hood three times width of shaft and about three times as long as its maximum width (Figs 5 E, 13 F, G). Thoracic uncini with eight to ten rows of teeth over main fang, covering slightly over half length of main fang (Fig. 13 H), with well-developed breast, reaching to the tip of main fang, neck half length of breast, and handle 1.5 – 2 times length of the distance between breast and main fang (Fig. 5 R). Thoracic neuropodial companion chaetae with subdistal end enlarged, conspicuous microtubercles forming hood resulting in dentate appearance, and with thin distal mucro, compressed laterally (Fig. 13 I). Abdominal neurochaetae narrowly hooded (Fig. 13 J). Abdominal uncini with about eight rows of teeth over main fang, covering half length of main fang (Fig. 13 K), neck shorter than breast, breast well developed and with medium-length handle, 1.5 times length of the distance between main fang and breast (Fig. 5 S). Pygidium a rim with a ventral anus (Fig. 13 L), several red eyespots on both sides. Variation: Specimens display variability for many features: size (4 – 22 mm length, 0.5 – 1.8 mm width), numbers of thoracic chaetigers (4 – 8), abdominal segments (ten to 63), number of radioles (5 – 12), and numbers of rows of vacuolated cells supporting radioles basally (six to ten). Dorsal radiolar appendages vary from 4 – 8 thoracic segments in length; pinnular appendages vary from 0 – 2 pairs. Collar completely covers base of crown in some specimens, but junction of peristomium and crown is laterally visible in some small specimens. Thoracic uncini vary in shape with handles one to two times length of the distance between breast and main fang, and 8 – 10 rows of teeth over main fang. Abdominal uncini have 6 – 10 rows of teeth over main fang and short- to medium-length handles (0.5 – 1.5 times length of the distance between main fang and breast; Fig. 5 S, T). There is not much variability, however, in the shape of inferior thoracic chaetae – their width varies from 2 – 3 times width of shaft and three times as long as its maximum width. Some of this morphological variability is summarized in Table 5. Preserved specimens vary from possessing little colour pigment in radioles (a few spots) to three to four pigment bands in crown, with pigmented radiolar pinnules, and longitudinal bars of pigment embedded in rachis of radioles (Fig. 12 A – C). Pygidial eyespots faded in some specimens. Tubes are tough and chitinous, with adherent sand particles, shell, and bryozoans. Reproductive features: Some specimens as small as 8 mm in body length contain eggs in abdominal segments. Genetic data: Within the definition of P. crassichaetae sp. nov. two subclades, well supported and significantly different, were recovered (Fig. 3 B, C). The same haplotype was found for Australian specimens and a single mitochondrialsequence obtained from Hawaiian populations. Comparisons of nuclear fragments showed that divergence between clades is up to 10.6 % (Table 4). One clade comprises specimens from Hawaii, Morphological features Distribution Specimens (Registration numbers) Abdominal uncini with WA NMVF 108905 *, NMVF 108908 *, AM W. 21996, AM W. 47144 *, medium handle and around AM W. 47148 – 9 ten rows of small teeth QLD AM W. 36448 *, AM W. 4392, AM W. 47178 – 80, AM W. 47151 above main fang NSW AM W. 47181 *, AM W. 31102, AM W. 46677, AM W. 31103 AM W. 37028 (PS 03), AM W. 37044 (PS 21), W. 37046 (PS 23), W. 37047 (PS 24), W. 37049 (PS 28) Hawaii AM W. 37036 (PS 12), AM W 47183 Abdominal uncini with short WA NMVF 108906, AM W. 36447, AM W. 47150 handle and six to seven NT AM W. 32579 (PS 16), AM W. 47147 rows of larger teeth above Hawaii AM W. 37034 (PS 10), AM W. 37035 (PS 11), AM W. 37037 (PS 13) main fang * Specimens with six to eight rows of vacuolated cells supporting the radioles basally. NSW, New South Wales; QLD, Queensland; NT, Northern Territory; WA, Western Australia. New South Wales, and the Northern Territory that differ by a maximum of 6.0 % of their ITS sequences (New South Wales and Northern Territory specimens, not shown). Specimens belonging to this clade are characterized by sharing several diagnostic nucleotide blocks such as CTACCCCCTGT in the 334 – 344 nucleotide positions and the ATCTGCTCTGGGCGGTCCT in the 586 – 584 nucleotide positions of the ITS alignment. The second clade, consisting of five specimens from three close localities in New South Wales, with only ITS fragments successfully sequenced, had the same haplotype with unique blocks, such as CTTCACTCTACCCCCTGT in the 327 – 377 nucleotide positions, ACGTCTGCCGGAC in the 356 – 368 nucleotide positions, and TGCAAGGAC CCGCCCCACATCTGCTCTGGGCGGTCCTCCTT in the 548 – 588 nucleotide positions in the ITS alignment. Remarks: Parasabella crassichaetae sp. nov. complex is characterized by exceptionally broad and short inferior thoracic chaetae with a thin distal tip, almost resembling paleae externally but with a shaft continuing through the hood and into the distal tip, a character that defines broadly hooded chaetae. This attribute is also shared by other congeneric species such as P. albicans, P. leucaspis, Parasabella langerhansi, Parasabella brevithoracica (Pillai, 1961), Parasabella pallida Moore, 1923, Parasabella saxicola (Grube, 1861), P. media, Parasabella tenuicollaris, P. tommasi, and Parasabella torulis (Table 2). Parasabella torulis is distinguished from the others by possessing thoracic ventral shields separated from neuropodial tori. All the other species have ventral shields in contact with neuropodial uncinial tori. Some of these species, such as P. media and P. leucaspis (Claparède, 1870; Knight-Jones, 1983; Perkins, 1984; Giangrande, 1994), differ from P. crassichaetae sp. nov. by the presence of radioles with more than 20 vacuolated cells in the bases of radioles. Parasabella leucaspis also possesses much shorter dorsal lips, only as long as one thoracic chaetiger compared with lengths more than four chaetigers in P. crassichaetae sp. nov. Both P. media and P. leucaspis also display variability in the shape of the inferior thoracic chaetae (Perkins, 1984), unlike P. crassichaetae sp. nov., which possesses only wide and short type A inferior thoracic chaetae.	en	Capa, María, Murray, Anna (2015): Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range. Zoological Journal of the Linnean Society 175 (4): 764-811, DOI: 10.1111/zoj.12308, URL: http://dx.doi.org/10.1111/zoj.12308
E41687B47E52FFB69E70FA70FDD8FB83.taxon	etymology	Etymology: The name of the species refers to the broad inferior thoracic chaetae, a distinct trait when compared with other Australian congeners. Type locality: Shellharbour, New South Wales, Australia. Distribution: Around Australian coasts except Victoria and South Australia (Fig. 1 B); Hawaii. Ecological notes: Specimens have been found in tropical and temperate environments in dead coral rubble, sponges, algae, and artificial surfaces in ports and harbours, from the intertidal to 25 m depth.	en	Capa, María, Murray, Anna (2015): Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range. Zoological Journal of the Linnean Society 175 (4): 764-811, DOI: 10.1111/zoj.12308, URL: http://dx.doi.org/10.1111/zoj.12308
E41687B47E65FF899ECCFD2FFA17F8D0.taxon	materials_examined	Type species: Parasabella minuta Treadwell, 1941. Diagnosis: Radiolar eyes irregularly distributed along outer margins, more numerous in areas with pigmented bands across radioles. Thoracic neuropodial companion chaetae with subdistal end enlarged, conspicuous microtubercles forming hood, resulting in dentate appearance, with thin distal mucro, generally flattened transversely. Description: Sabellids ranging in length from 3 – 30 mm (including crown); thorax with 4 – 8 chaetigers and abdomen with numerous chaetigers. Radiolar crown with four to 22 pairs of radioles arranged in two semicircular radiolar lobes, may be involuted dorsally. Radioles without basal membrane, stylodes, or radiolar flanges; outer margins with numerous, irregularly distributed eyespots, usually more numerous in areas with pigmented bands across radioles. Radioles supported by four to six rows of vacuolated cells at bases. Dorsal lips with radiolar appendages; pinnular appendages absent or present, one to two pairs when present, may be fused partially to dorsal lip; distally rounded ventral lips, continuing ventrally as parallel lamellae; ventral sacs present or absent. Peristomial eyespots present subdermally. Posterior peristomial ring collar only just covering branchial lobes; dorsal margins well separated from faecal groove; one pair of triangular, nonoverlapping ventral lappets. Inter-ramal eyespots present, especially evident in abdomen, but may be faded or absent. Collar chaetae elongate, narrowly hooded, arranged in two oblique rows, ventral row chaetae shorter than dorsal; remaining thoracic notopodia with superior arc of elongate, narrowly hooded chaetae, inferior chaetae as two rows of broadly hooded chaetae of type A. Thoracic neuropodia with avicular uncini about as long as high, 4 – 5 irregular rows of teeth above main fang, extending less than half the length of main fang, well-developed breast, and medium handles (as long as distance from breast to main fang). Thoracic neuropodial companion chaetae with subdistal end enlarged, conspicuous microtubercles forming hood, resulting in dentate appearance, and with thin distal mucro at right angles to shaft and flattened transversely. Abdominal neurochaetae narrowly hooded in both anterior and posterior rows. Abdominal notopodia with avicular uncini similar to thoracic or with shorter handles. Pygidium triangular, distally blunt; eyespots present. Remarks: The description of Sabellomma is here emended to incorporate the morphological differences observed in the new species and changes in the interpretation of the shape of the inferior thoracic chaetae. Sabellomma cupoculata sp. nov. lacks inter-ramal eyes, the dorsal margins of branchial lobes do not possess thickened ridges but instead radiolar lobes are involuted dorsally, peristomial eyes are present, companion chaetae with a very thin distal mucro are present, radioles are supported by six rows of vacuolated cells, and specimens with up to eight thoracic segments have been found; all different from previously described Sabellomma species (Nogueira et al., 2010). Moreover, in the original description of the genus, the inferior thoracic chaetae of members of Sabellomma were considered as paleate, but as the shaft runs through the hood, the chaetae should be considered as broadly hooded (Perkins, 1984; Fitzhugh, 1989; Capa et al., 2015). Sabellomma cupoculata sp. nov. lacks the ventral sacs described for the other three nominal species in the genus (Nogueira et al., 2010). The genus Sabellomma was erected to accommodate the type species previously considered as a Parasabella and subsequently as a Perkinsiana Knight-Jones, 1983 (Treadwell, 1941; Knight-Jones, 1983), from Brazil, together with two new additional species from Hawaii and the Caribbean, all characterized by the presence of unpaired, simple eyespots along the outer margins of radioles and possibly also inter-ramal spots (Nogueira et al., 2010). Both characters were considered as homoplastic because they have been reported in other sabellids (Nogueira et al., 2010). This type and arrangement of radiolar eyes is also described in P. microphthalma (Perkins, 1984) and in Pseudopotamilla cerasina (Grube, 1870). However, their presence in Parasabella microphthalma may be inaccurate and pigment spots mistakenly interpreted as eyespots (according to Nogueira et al., 2010), and Ps. cerasina, from the description (in which types were apparently not assigned) and from further notes on some other identified specimens, may actually be a Sabellomma and not Sabella, Potamilla, or Pseudopotamilla as previously suggested (Grube, 1870; Knight-Jones, Knight-Jones & Ergen, 1991; Knight-Jones & Perkins, 1998). These two species may have the same type of companion chaetae and radiolar eyes as members of Sabellomma. Moreover, although Ps. cerasina apparently bears dorsal radiolar flanges, similar to those present in all members of Pseudopotamilla (Knight-Jones & Perkins, 1998), these could be in fact the basal, thickened ridges described in Sabellomma (Nogueira et al., 2010: 4). Conspicuous differences between Pseudopotamilla and Sabellomma, apart from the types of radiolar eyes, lie in the posterior peristomial ring collar dorsal margins, fused to the faecal groove in Pseudopotamilla and separated by a wide gap in Sabellomma; and the type of interior thoracic chaetae, paleate (that is, with the shaft not reaching the tip of the hood) in Pseudopotamilla, and broadly hooded (with shaft along the hood), in Sabellomma. If this synonymy is verified then the presence of simple eyespots along the outer margins of radioles will be the synapomorphy for the genus. SABELLOMMA CUPOCULATA SP. NOV. (FIGS 4 H, 5 H, Y, Z, 18, 19) Holotype: AM W. 47193, Queensland, Lizard Island, High Rock, 14 ° 49 ′ 34 ″ S, 145 ° 33 ′ 08 ″ E, coll. from coral rubble, 20.1 m depth, L. Avery, 11. ix. 2010, CReefs Stn LI 10 - 134, MI QLD 2233. Paratypes: AM W. 47192 (1), same as holotype; AM W. 47191 (4), Lizard Island, MacGillivray Reef (14 ° 39 ′ 23 ″ S, 145 ° 29 ′ 31 ″ E, coll. from coral rubble, 22 m, M. Capa & P. Hutchings, 29. viii. 2010, CReefs Stn LI 10 - 028, MI QLD 2197. Additional material examined (see Appendix for details): Australia. Western Australia: Lewis Island (two), Legendre Island (one); Northern Territory: Darwin Harbour (one); Queensland: Torres Strait (one); Lizard Island, (nine), Heron Island (one). Diagnosis: Unpaired, simple eyespots present, randomly arranged along radiolar lateral margins. Radioles supported by six rows of vacuolated cells near base. Thoracic ventral shields in contact with neuropodial tori. Inferior thoracic notochaetae of type A, with hoods 1.5 times as wide as shaft, and as long as four to five times maximum width. Thoracic uncini with short handles, and neck slightly shorter than breast. Description: Holotype 7 mm long (excluding crown), 1 mm wide, radiolar crown 5 mm long. Thorax with seven chaetigers, abdomen with 47. Preserved holotype brown with white spots all over body (Fig. 18 K). Radiolar crown with basal lobes as long as 1.5 thoracic segments, arranged in two semicircles (Figs 18 C – D, H – J, 19 A – D), slightly involuted dorsally. Radioles with rounded edges, flanges absent, with six rows of vacuolated cells supporting each radiole near base (Fig. 4 H). Radiolar tips wide, tapering, bare for approximately length of pinnules. Cup-shaped radiolar eyes irregularly arranged along side margins of all radioles, except distally (Fig. 18 E – G). Dorsal lips with radiolar appendages as long as three thoracic seg- ments (Figs 18 H – J, 19 D). One pinnular appendage fused to each dorsal lip, free for one-half to one-third of length, and joined to adjacent pinnule by membrane (Fig. 18 I, J). Ventral lamellae present, ventral sacs absent (Fig. 18 H). Posterior peristomial ring collar slightly increasing in length from dorsal to ventral side, covering junction of crown and peristomium, with low rounded ventral lappets, shorter than one thoracic segment (Figs 18 A – D, H, K, L, 19 A – D); dorsal margins with rounded edges (Figs 18 D, 19 D). Peristomial eyes present, subdermal. Inter-ramal eyes absent. Thoracic ventral shields four times wider than long, lateral margins in contact with neuropodial tori; first ventral shield m-shaped, twice as wide as long, with indentation along anterior margin. Collar chaetae elongate, narrowly hooded. Superior thoracic notochaetae elongate, broadly hooded (Fig. 19 E); inferior thoracic notochaetae of remaining chaetigers with broadly hooded chaetae with progressively tapering distal tips (type A), with hoods 1.5 times width of shaft, and as long as 4 – 5 times maximum width (Figs 5 H, 19 E, F). Neuropodial tori similar in width along thorax, only slightly decreasing in width posteriorly. Uncini with 5 – 6 rows of teeth over main fang, covering just half length of main fang (Fig. 19 G), well-developed breast, not reaching tip of main fang, neck longer than breast, handle short (shorter than the length of the distance between breast and main fang; Fig. 5 Y). Thoracic neuropodial companion chaetae with subdistal end enlarged, conspicuous microtubercles forming hood, resulting in dentate appearance, and thin distal mucro flattened transversely, narrowing abruptly, tapering to long fine point (Fig. 19 H – J). Abdominal neurochaetae narrowly hooded (Fig. 19 K). Abdominal uncini with 5 – 6 rows of large teeth over main fang covering half length of main fang (Fig. 19 L, M), uncinus proportionally higher than thoracic, with less defined breast and handle shorter than length of the distance between main fang and breast. Abdominal uncini decrease in size dorsoventrally within same torus. Pygidium a rim with ventral anus (Fig. 19 N); red eyespots on both sides. Variation: Specimens range in length from 3 (AM W. 20495) to 37 mm (AM W. 37060), including crown, with widths of 0.3 – 2.3 mm. Thoracic chaetigers vary from 5 – 8. Collar varies in height from length of one to two thoracic segments – larger specimens (AM W. 47189, AM W. 37060) have higher collars with subquadrate dorsal margins, and 7 – 8 thoracic chaetigers, as well as more pronounced involution of dorsal radioles. Number of radioles varies from 5 – 22 pairs. Dorsal lips vary in length between 3 – 5 thoracic chaetigers. Ventral shields vary from 2 – 4 times wider than long, depending on contraction and type of fixation. Radiolar crown of live specimens with brownish base and some brown (∼ five), white (∼ seven), and purple (three to four) transverse bands irregularly arranged across radioles and pinnules (Fig. 18 A – D). Colour patterns amongst specimens from Lizard (Fig. 18 A) and Heron Islands (Fig. 18 B – D) show some minor differences in number and width of colour bands in radiolar crown, but all specimens with brown radiolar base with white and bright purple transverse bands and small white spots over trunk. Some preserved specimens have little or no pigment remaining (Fig. 18 H), whereas others remain brown (Fig. 18 K). Pigment fades first from abdomen. Some specimens with little or no pigment in thorax after preservation may have small spots of pigment retained on ventral margin of the thoracic notopodial tori as well as ventral edges of neuropodial tori (Fig. 18 H), unlikely to be eyes, and these appear to fade completely. Reproductive features: None of the examined specimens were gravid females but some nontype specimens, greater than 8 mm in length, possessed sperm in anterior abdominal segments, forming creamywhite dorsolateral patches. Genetic data: This species shows little genetic intraspecific variation (2.7 and 0.3 %, comparing cox 1 and ITS sequences, respectively). The specimens collected from Heron and Lizard Islands show the largest divergence, suggesting some population structure along the reported distribution range. The four specimens included in the analyses are characterized by several synapomorphies or barcodes, with some nucleotides scattered along the sequences and others, such as GCGCGTCCTGCGTTCCCTCCCCTCG in the 489 – 513 nucleotide positions, configuring unique sequence blocks. The present phylogenetic hypothesis (Fig. 3 C), after combination of the molecular and mitochondrial sequence data, suggests a sister-group relationship between Parasabella and Sabellomma, with maximum bootstrap support and genetic differences of over 25 % in mitochondrial DNA fragments and over 40 % in the nuclear fragment. Remarks: Sabellomma cupoculata sp. nov. resembles the other congeners, all described from the Western Atlantic, in the presence of irregularly distributed lensed eyes on outer margins of radioles, and the presence of companion chaetae with a transversely flattened distal mucro. The main differences between S. cupoculata sp. nov. and previously described species are: the shape of these companion chaetae (the mucro narrows abruptly and looks almost needle-like under light microscopy in S. cupoculata sp. nov., whereas the other three species have broader distal ends); radioles are supported by six vacuolated cells in S. cupoculata sp. nov. and four in the other three species; and the radiolar lobes lack a thickened ridge on their dorsal edge, present in the other Sabellomma species, but are instead slightly involuted dorsally in S. cupoculata sp. nov. Moreover, none of the species previously reported have bright purple bands in the crown when alive, whereas these are very conspicuous in the new Australian species. Sabellomma cupoculata sp. nov. resembles P. microphthalma in the type and arrangement of radiolar eyes in two irregular rows on outer sides of the radioles, if it can be verified that they are present in the latter species. However, these two species differ in the type of companion chaetae, which are representative of each of the two genera, and also in the	en	Capa, María, Murray, Anna (2015): Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range. Zoological Journal of the Linnean Society 175 (4): 764-811, DOI: 10.1111/zoj.12308, URL: http://dx.doi.org/10.1111/zoj.12308
E41687B47E60FF8B9DD7FA31FBB2FEEB.taxon	description	RELATIONSHIPS WITH OTHER SABELLIDS All species in Parasabella share the presence of companion chaetae with bulbous subdistal ends with a dentate appearance and a narrow tapered mucro arising from the centre and compressed laterally, which is unique in Sabellidae (Knight-Jones, 1983; Perkins, 1984; Fitzhugh, 1989; Capa et al., 2015). Monophyly of the genus was indicated herein (although weakly support- ed) for the first time, after analyses of molecular data. The monophyly of Sabellomma has already been assessed by Nogueira et al. (2010), after analyses of morphological data and considering a comprehensive number of sabellid terminals. It relies on the presence of unpaired eyes distributed along the radioles (Nogueira et al., 2010; and see explanation as to why some of the phylogenetic hypotheses tested recovered Sabellomma as paraphyletic). The phylogenetic hypothesis after combining nuclear and mitochondrial sequence data indicated a sistergroup relationship between Parasabella and Sabellomma. This result differs from a previous hypothesis that recovered Parasabella (as Demonax) as sister-group to Megalomma (Nogueira et al., 2010). These three genera, however, share several morphological features, all homoplastic. They bear broadly hooded inferior thoracic notochaetae (Fitzhugh, 1989; Capa & Murray, 2009; Tovar-Hernández & Carrera-Parra, 2011, and present study; see Nogueira et al., 2010 for a different interpretation in Sabellomma), also shared by members of Claviramus Fitzhugh, 2002, Euchoneira Licciano, Giangrande & Gambi, 2009, Glomerula Nielsen, 1931 Potamilla Malmgren, 1866, and Terebrasabella Fitzhugh & Rouse, 1999, amongst others (Nogueira et al., 2010; Capa et al., 2015). Moreover, Sabellomma and most members of Megalomma and Parasabella bear pinnular appendages associated with the dorsal lips, a feature that has also been reported in other sabellids, for example, Anamobaea Krøyer, 1856, Bispira Krøyer, 1856, Branchiomma Kölliker, 1858, Potamilla Malmgren, 1866, and Pseudopotamilla Buch, 1905 (Nogueira et al., 2010; Capa et al., 2015). The presence of a short thorax with fewer than the typical eight chaetigers has been considered as a characteristic of species of Sabellomma and some Parasabella (e. g. Knight-Jones, 1983; Perkins, 1984; Nogueira et al., 2010) but has also been reported in Megalomma (Knight-Jones, 1983; Tovar-Hernández & Carrera-Parra, 2011) and many other sabellids (e. g. Knight-Jones & Perkins, 1998; Nogueira & Knight-Jones, 2002; Fitzhugh, 2003; Nogueira, López & Rossi, 2004; Capa, Pons & Hutchings, 2013). Members of Parasabella and Megalomma have also been reported with more than eight thoracic chaetigers (Knight-Jones, 1983; Knight-Jones & Walker, 1985; Tovar-Hernández & Carrera-Parra, 2011). But if an anomalous number of thoracic segments is indeed a consequence of imperfect regeneration after damage or reproduction by scissiparity, (Knight-Jones & Bowden, 1984; Nogueira & Knight-Jones, 2002; Fitzhugh, 2003; Nogueira et al., 2004; Capa, 2008), then intact specimens with the typical number of thoracic segments may also exist (even if not yet found) and thus this feature would not be diagnostic. At least some species of each of the three genera bear radiolar eyes, but if considered absent in P. microphthalma (as in Nogueira et al., 2010), their number and arrangement show large differences amongst members of the three genera. Megalomma is characterized by the presence of subdistal, sessile, and compound radiolar eyes, at least on the internal margin of the dorsal-most pair of radioles (Fitzhugh, 1989; Capa & Murray, 2009; Tovar-Hernández & Carrera-Parra, 2011), a synapomorphy for the genus. Sabellomma bears numerous, unpaired, randomly arranged eyespots along the outer margin of all radioles (Nogueira et al., 2010), a synapomorphy for the genus. Finally, Parasabella lacks eyes, except for the newly described species P. bioculata, which has paired simple eyespots on both sides of the distal radiolar tips of most radioles. Morphologically, Sabellomma and Megalomma share the shape of the companion chaetae, with a distal teardrop ‘ membrane’, albeit very narrow in the hereindescribed S. cupoculata. By contrast, the mucro is at an angle in Parasabella, appearing as compressed laterally instead of flattened transversely. Some members of Sabellomma and Megalomma also have ventral sacs as a continuation of the ventral lips, whereas they have not been observed in Parasabella. The previously described three species of Sabellomma were characterized by the presence of inter-ramal eyespots, more conspicuous in the abdominal region (Nogueira et al., 2010), but this is a feature that has also been reported from some Megalomma species (Capa & Murray, 2009; Tovar-Hernández & Carrera-Parra, 2011) and is lacking (or completely faded) from S. cupoculata sp. nov.	en	Capa, María, Murray, Anna (2015): Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range. Zoological Journal of the Linnean Society 175 (4): 764-811, DOI: 10.1111/zoj.12308, URL: http://dx.doi.org/10.1111/zoj.12308
E41687B47E68FF809DBDFC6BFE84FAB5.taxon	materials_examined	Additional material examined: Australia. Western Australia: AM W. 46997 (one), Ningaloo Reef, north of Tantabiddi, lagoon off Jurabi Point, patch reef, 21 ° 51 ′ 41 ″ S, 113 ° 59 ′ 46 ″ E, reef rock with brown algae, 3.5 m, vi. 2008. New South Wales: AM W. 46840 (one), Port Stephens, Nelson Bay, 32 ° 42 ′ 56 ″ S, 152 ° 08 ′ 58 ″ E, soft coral, 11.3 m, ii. 2011. Timor-Leste. AM W. 46835 (one), east of Atauro Island, Inner Reef, reef slope, 8 ° 14 ′ 30 ″ S, 125 ° 36 ′ 49 ″ E, dead coral rubble and algae, 14 m, ix. 2012.	en	Capa, María, Murray, Anna (2015): Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range. Zoological Journal of the Linnean Society 175 (4): 764-811, DOI: 10.1111/zoj.12308, URL: http://dx.doi.org/10.1111/zoj.12308
E41687B47E68FF839DE6FA99FDFBF9A0.taxon	materials_examined	Additional material examined: Australia. Western Australia. NMV F. 108905 (one), north-east end of Vancouver Peninsula, off Albany, 35 ° 03 ′ 24 ″ S, 117 ° 56 ′ 12 ″ E, red algae, 10 m, 8. iv. 1984; NMV F. 108906 (three), western end of Lucky Bay, near Esperance, 33 ° 59 ′ S, 122 ° 14 ′ E, sponges, red and coralline algae, 12. iv. 1984; NMV F. 108908 (three), north end of Little Beach, Two Peoples Bay, 34 ° 58 ′ 24 ″ S, 118 ° 11 ′ 42 ″ E, tufted algae, 5 – 12 m, 5. iv. 1984; AM W. 47148 (five), Ningaloo Reef, 22 ° 37 ′ 25 ″ S, 113 ° 38 ′ 28 ″ E, coarse coral rubble, 7 m, 20. v. 2009, CReefs Ningaloo 2009 Expedition, WA 1038; AM W. 47150 (many), AM W. 36447 (two on SEM pins), Ningaloo Reef, 22 ° 45 ′ 19 ″ S, 113 ° 42 ′ 40 ″ E, sponge and bryozoan, 17 m, 19. v. 2009, CReefs Ningaloo 2009 Expedition, WA 1035; AM W. 47144 (three), Dampier Archipelago, west of Angel Island, 20 ° 29 ′ 03 ″ S, 116 ° 47 ′ 50 ″ E, dead coral, 6 m, 25. vii. 2000, WA 619; AM W. 47149 (six), Dampier Archipelago, Enderby Island, 2 km west of Rocky Head, 20 ° 37 ′ 06 ″ S, 116 ° 26 ′ 43 ″ E, dead coral, 14 m, 3. viii. 2000, WA 637; AM W. 21996 (two), outer Bunbury Harbour, 33 ° 18 ′ 25 ″ S, 115 ° 38 ′ 35 ″ E, 10.1 m, 27. iii. 1993. Northern Territory. AM W. 32579 (one = PS 16), Darwin, East Point Reef, 12 ° 27 ′ S, 130 ° 50 ′ E, intertidal, 17. ix. 2005; AM W. 36298 (one on SEM stub), Darwin Harbour, West Point, 12 ° 26 ′ 14 ″ S, 130 ° 46 ′ E, coral rubble, sponges, and algae, 6 – 8 m, 17. vii. 1993, NT 324; AM W. 47147 (one), Darwin Harbour, Weed Reef, 12 ° 30 ′ S, 130 ° 48 ′ E, coral rubble, 4 m, 6. vii. 1993, NT 348. Queensland. AM W. 47151 (one), Weipa, Evans Landing Wharf, 12 ° 40 ′ S, 141 ° 57 ′ E, x. 1999, scraping from wharf piles, ‘ P 1014 ’, CRIMP QLD Ports Survey; AM W. 47177 (one), Weipa, Evans Landing Wharf, 12 ° 40 ′ S, 141 ° 57 ′ E, x. 1999, benthic grab, ‘ P 973 ’, CRIMP QLD Ports Survey; AM W. 36448 (one, plus one on SEM pin), Weipa, Humbug Point Wharf, 12 ° 40 ′ S, 141 ° 57 ′ E, x. 1999, ‘ P 862 ’, CRIMP QLD Ports Survey; AM W. 47152 (one), Weipa, Lorim Point Wharf, 12 ° 40 ′ S, 141 ° 57 ′ E, x. 1999, scraping from wharf piles, ‘ P 962 ’, CRIMP QLD Ports Survey; AM W. 47178 (one), Weipa, Evans Landing Wharf, 12 ° 40 ′ S, 141 ° 57 ′ E, x. 1999, ‘ P 1020 ’, CRIMP QLD Ports Survey; AM W. 47179 (five), Cairns, Wharf 12, 16 ° 52 ′ S, 145 ° 49 ′ E, 20. xi. 2001, ‘ P 3207 ’, CRIMP QLD Ports Survey; AM W. 47180 (one), Cairns, Wharf 1, 16 ° 52 ′ S, 145 ° 49 ′ E, 18. xi. 2001, shrimp trap, ‘ P 3024 ’, CRIMP QLD Ports Survey. New South Wales. W 25992 (one), South Ledge, Cook Island, 28 ° 11 ′ 39 ″ S, 153 ° 34 ′ 38 ″ E, colonial ascidian, 9. vi. 1993; W 25993 (three), South Ledge, Cook Island, 28 ° 11 ′ 39 ″ S, 153 ° 34 ′ 38 ″ E, frilly bryozoan, 9. vi. 1993; W 25984 (one), Byron Bay, 100 m north-west of Julian Rocks, 28 ° 36 ′ 48 ″ S, 153 ° 37 ′ 48 ″ E, rock with finger sponge, 03. iii. 1992; W 25985 (one), Byron Bay, 100 m northwest of Julian Rocks, 28 ° 36 ′ 48 ″ S, 153 ° 37 ′ 48 ″ E, shelly sand amongst turf on top of rocks, 4. iii. 1992; W 25986 (one), 100 m north-west of Split Solitary Island, 30 ° 14 ′ S, 153 ° 10 ′ 48 ″ E, encrusting algae and ascidians, 7. iii. 1992; W 25987 (one), 100 m north-west of Split Solitary Island, 30 ° 14 ′ S, 153 10 ′ 48 ″ E, brown algae, 7. iii. 1992; W 25990 (one), Solitary Islands, 200 m north of Korffs Islet, 30 ° 18 ′ 54 ″ S, 153 ° 09 ′ 18 ″ E, mixed sponges, 22. vi. 1992; W 25991 (one), Solitary Islands, 100 m north of Korffs (Pig) Islet, 30 ° 19 ′ S, 153 ° 09 ′ 18 ″ E, Ecklonia holdfasts, 26. vi. 1992; W 25988 (one), Coff’s Harbour, Coff’s Harbour Jetty, 30 ° 18 ′ 24 ″ S, 153 ° 08 ′ 30 ″ E, orange sponge on jetty pilings, 9. iii. 1992; W 25989 (one), Coff’s Harbour, Coff’s Harbour Jetty, 30 ° 18 ′ 24 ″ S, 153 ° 08 ′ 30 ″ E, finger sponge on jetty pilings, 9. iii. 1992; AM W. 32572 (one) Port Stephens, Nelson Bay marina, 32 ° 42 ′ 58 ″ S, 152 ° 09 ′ 00 ″ E, 14. iii. 2006, brown algae, 0.1 m, NSW 3058; AM W. 47181 (ten), south of Point Stephens Lighthouse, 32 ° 45 ′ 02 ″ S, 152 ° 11 ′ 35 ″ E, from small brown cup sponge, 16 m, 31. v. 1998, NSW 1492; AM W. 27830 – 32 (nine), Port Jackson, Garden Island, 33 ° 51 ′ 48 ″ S, 151 ° 13 ′ 44 ″ E, scrapings from jetty piles, 0.5 – 5 m, 21. v. 2001, Sydney Ports Survey; AM W. 37037 (one = PS 13), Port Jackson, White Bay Berth 3, 33 ° 51 ′ 47 ″ S, 151 ° 11 ′ 00 ″ E, scrapings from wharf piles, 11.8 m, 5. iii. 2009, MI NSW 3399; AM W. 27835 (one) Port Jackson, White Bay, 33 ° 51 ′ 40 ″ S, 151 ° 11 ′ 25 ″ E, scrapings from wooden piles, 7 m, 18. iv. 2001, Sydney Ports Survey; AM W. 47184 (one), Port Jackson, Glebe Island east, 33 ° 51 ′ 59 ″ S, 151 ° 11 ′ 11 ″ E, scrapings from cement facing, 3 m, 18. iv. 2001, Sydney Ports Survey; AM W. 37044 (four in 95 % ethanol, one of which = PS 21), north-east of Kurnell, ‘ Anchor Reef’, 34 ° 00 ′ 33 ″ S, 151 ° 13 ′ 51 ″ E, rock scrapings, 17.8 m, 16. iii. 2009, MI NSW 3423; AM W. 37049 (one in 95 % ethanol = PS 28), Jolong Reef, approximately 700 m north-east of Cape Banks, 33 ° 59 ′ 48 ″ S, 151 ° 15 ′ 14 ″ E, from sediment on rock, 20.5 m, 21. vii. 2009, MI NSW 3642; AM W. 37046 (one in 95 % ethanol = PS 23), same locality and date, sponges, 22.5 m, MI NSW 3645; AM W. 37047 (one in 95 % ethanol = PS 24), from same sample, MI NSW 3645; AM W. 46708 (two in 95 % ethanol), Botany Bay, east of Inscription Point, 34 ° 11 ′ 01 ″ S, 151 ° 13 ′ 23 ″ E, tube of Sabella spallanzanii on rock, 12 m, 6. iii. 2012, MI NSW 4093; AM W. 43270 (> five in 95 % ethanol), Botany Bay, off Inscription Point, 34 ° 00 ′ 08 ″ S, 151 ° 13 ′ 30 ″ E, scraping from rock, 11 m, 28. v. 2013, MI NSW 4152; AM W. 37028 (one = PS 03), Shellharbour, north-east of Bass Point, ‘ The Humps’, 34 ° 35 ′ 35 ″ S, 150 ° 54 ′ 22 ″ E, from orange sponge, 22.4 m, 4. v. 2010, MI NSW 3956; W 25994 (one), east side of Plantation Point, Jervis Bay, 35 ° 04 ′ 30 ″ S, 150 ° 41 ′ 36 ″ E, foliose coralline algae on rock platform, high intertidal, 27. vi. 1981, NSW 41; AM W. 47185 (one), north of Batemans Bay, north-west side of Brush Island, 35 ° 31 ′ 39 ″ S, 150 ° 24 ′ 58 ″ E, from Caulerpa algae, 12 – 14 m, 9. ii. 2003, NSW 2031; AM W. 31103 (two, one on SEM stub), west side of Wasp Island, north of Batemans Bay, 35 ° 40 ′ 02 ″ S, 150 ° 18 ′ 29 ″ E, from alga Peyssonelia novae-hollandiae, 16 m, 10. ii. 2003, NSW 2047; AM W. 31102 (three), south of Batemans Bay, north of Burrewarra Point, east wall, 35 ° 50 ′ 01 ″ S, 150 ° 14 ′ 10 ″ E, from alga Peyssonelia novae-hollandiae, 25 m, 25. x. 2002, NSW 1985. USA. Hawaii. AM W. 37034 (one = PS 10), AM W. 37035 (one = PS 11), AM W. 37036 (one = PS 12), AM W. 47183 (five), Oahu, Coconut Island, 21 ° 25 ′ 48 ″ N, 157 ° 57 ′ 43 ″ W, 0.5 m, intertidal epifauna, 4. xi. 2008.	en	Capa, María, Murray, Anna (2015): Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range. Zoological Journal of the Linnean Society 175 (4): 764-811, DOI: 10.1111/zoj.12308, URL: http://dx.doi.org/10.1111/zoj.12308
E41687B47E6BFF829EDBFA31FB49FE2D.taxon	materials_examined	Additional material examined: Australia. Western Australia: AM W. 47189 (two), south-west tip of West Lewis Island, 20 ° 36 ′ 15 ″ S, 116 ° 35 ′ 43 ″ E, gravel, 10 m, 27. vii. 2000, WA 623; AM W. 47190 (one), Dampier Archipelago, Legendre Island, 1 km north-east of Cape Legendre, 20 ° 21 ′ 16 ″ S, 116 ° 50 ′ 34 ″ E, under small boulders, 27 m, 6. viii. 2000, WA 644. Northern Territory: AM W. 47188 (one), Darwin Harbour, North Shell Island, 12 ° 29 ′ 48 ″ S, 130 ° 53 ′ 12 ″ E, sponges and algae in coral rubble, 5 – 8 m, 16. vii. 1993, NT 346. Queensland: AM W. 30495 (one), Torres Strait, Prince of Wales Island, bommies northwest of Bamfield Point, 10 ° 41 ′ 08 ″ S, 142 ° 06 ′ 02 ″ E, live coral, 3 m, 3. x. 2006, QLD 1927; MAGNT W 23104 (five, one on SEM pin = AM W. 39545.001), Lizard Island, off North Head, 14 ° 38 ′ 44 ″ S, 145 ° 27 ′ 12 ″ E, 12 m, 14. iv. 2008, CReefs Stn CGLI – 025; AM W. 37061 (one = PS 41), Lizard Island, MacGillivray Reef, 14 ° 39 ′ 23 ″ S, 145 ° 29 ′ 31 ″ E, coral rubble, 22 m, 29. viii. 2010, MI QLD 2197, CReefs Stn LI 10 – 028; AM W. 37029 – 37030 (two, one = PS 06), Lizard Island, High Rock, 14 ° 49 ′ 34 ″ S, 145 ° 33 ′ 08 ″ E, coral rubble, 20.1 m, 11. ix. 2010, MI QLD 2233, CReefs Stn LI 10 – 134; AM W. 37057 (one = PS 37), MacGillivray Reef, deep reef slope, 14 ° 39 ′ 25 ″ S, 145 ° 28 ′ 22 ″ E, coral rubble, 30 m, 4. ix. 2010, CReefs Stn LI 10 – 073; AM W. 37060 (one = PS 40), Heron Island, Sykes reef, 23 ° 25 ′ 57 ″ S, 151 ° 02 ′ 02 ″ E, coarse coral rubble, 30 m, 14. xi. 2009, MI QLD 2073, CReefs.	en	Capa, María, Murray, Anna (2015): Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range. Zoological Journal of the Linnean Society 175 (4): 764-811, DOI: 10.1111/zoj.12308, URL: http://dx.doi.org/10.1111/zoj.12308
