identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
E41687B47E4CFFA49E1EFA32FA3EF8D1.text	E41687B47E4CFFA49E1EFA32FA3EF8D1.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Parasabella Bush 1905	<div><p>GENUS PARASABELLA BUSH, 1905, EMENDED</p> <p>Demonax Kinberg, 1867: 354 (not Thomson, 1860); 1910: 72. – Johansson, 1925: 26–27; 1927: 136. – Knight-Jones, 1983: 254. – Perkins, 1984: 292–293. – Knight-Jones &amp; Walker, 1985: 605. – Fitzhugh, 1989: 75–76. – Giangrande, 1994: 229–230.</p> <p>Parasabella Bush, 1905: 191, 199–200. – Johansson, 1927: 136. – Tovar-Hernández &amp; Harris, 2010: 14.</p> <p>Distylidia Hartman, 1961: 129. – Fauchald, 1977: 138. – Banse, 1979: 870.</p> <p>Type species: Parasabella media Bush, 1905 (see Read, 2010, contrary to Tovar-Hernández &amp; Harris, 2010).</p> </div>	https://treatment.plazi.org/id/E41687B47E4CFFA49E1EFA32FA3EF8D1	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Capa, María;Murray, Anna	Capa, María, Murray, Anna (2015): Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range. Zoological Journal of the Linnean Society 175 (4): 764-811, DOI: 10.1111/zoj.12308, URL: http://dx.doi.org/10.1111/zoj.12308
E41687B47E49FFBD9E27F967FAE9FA08.text	E41687B47E49FFBD9E27F967FAE9FA08.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Parasabella aberrans (Augener 1926)	<div><p>PARASABELLA ABERRANS (AUGENER, 1926) SPP. COMPLEX (FIGS 2C, 4A, 5B, J–L, 6, 7)</p> <p>Sabella aberrans Augener, 1926: 245–253, fig. 18.</p> <p>Sabella porifera – Augener, 1914: 106–109 (in part).</p> <p>Demonax aberrans – Knight-Jones &amp; Perkins, 1998: 404.</p> <p>Parasabella aberrans – Tovar-Hernández &amp; Harris,</p> <p>2010: 14.</p> <p>Holotype: ZMUC –POL–2115, Little Barrier Island, New Zealand, 55 m depth, 29.xii.1914, Dr Th. Mortensen Pacific Expedition.</p> <p>Additional material examined (see Appendix for details): Western Australia: Bunbury (one); Ningaloo reef (three); Northern Territory: Darwin Harbour (one); Queensland: Lizard Island (three); New South Wales: Coffs Harbour (one), Port Stephens (eight), Newcastle (four), Malabar (one), Botany Bay (12), Port Kembla (one), Bass Point (one), Jervis Bay (two), Ulladulla (two), Tathra (three), Batemans Bay (one), Point Upright (one), Eden (eight), Twofold Bay (eight); South Australia: Kangaroo Island (nine), Port Hughes (two).</p> <p>Diagnosis: Stiff, fleshy swelling occupying dorsum of first two chaetigers, with transverse ridge and forming posterior-facing pocket(s), either continuous across dorsum or separated by faecal groove (synapomorphy for this species complex). Radiolar eyes absent. Radioles supported basally by 14–20 rows of vacuolated cells in cross-section. Thoracic ventral shields in contact with neuropodial tori. Inferior thoracic notochaetae broadly hooded, of type B; hoods 1.5 times the width of shaft, and as long as four to five times maximum width. Thoracic uncini with medium-length handles.</p> <p>Description of Australian specimens: 2.3 to 35 mm long, 0.5 to 3 mm wide, 5–8 thoracic chaetigers, 20 to&gt; 60 abdominal chaetigers. Radiolar crown with long basal lobes (∼ two thoracic segments), radioles arranged in two semicircles, curling inward in larger specimens. Six to 14 pairs of radioles, each supported basally by 14–20 rows of vacuolated cells in cross-section (Fig. 4A). Radioles with wide, tapering tips, bare for the length of two thoracic segments. Radiolar flanges and eyes absent. Dorsal lips with radiolar appendages as long as 4–6 thoracic segments; 0–2 dorsal pinnular appendages. Posterior peristomial ring collar of even length all way round (Figs 6B, 7A, B) or oblique laterally (Fig. 7C), reaching junction of crown and thorax (Figs 6A, 7C), with midventral incision and broad ventral lappets with rounded anterior margins (Figs 6C, 7A); dorsal margins subquadrate (Figs 6D–F, 7D, E). Peristomial eyes shallowly embedded under base of radiolar crown. Fleshy swelling with transverse ridge, occupying dorsum of first two chaetigers, forming either two posteriorfacing sinuses or pockets separated by faecal groove (Figs 6D, E, 7D), or continuous across faecal groove forming one large posterior-facing pocket (Figs 6F, 7E). Ventral glandular shields similar in width to each other, in contact with tori (Figs 6B, C, 7A); first ventral shield one to two times length of following, with anterior margin m-shaped (Fig. 6C). Collar chaetae elongate, narrowly hooded (Fig. 7F). Superior thoracic notochaetae elongate, narrowly hooded, inferior group with two rows of shorter broadly hooded chaetae of type B (Figs 2C, 5B, 6G), with hoods as long as 4–5 times maximum width and maximum width 1.5 times width of shaft. Thoracic neuropodial tori slightly diminishing in width posteriorly (Figs 6B, 7A, B). Uncini with about 10 rows of similar-sized teeth above main fang, covering more than half length of main fang (Fig. 7I, J), neck as long as breast, well-developed breast and medium-length handles (∼1.5 times distance from main fang to breast) (Fig. 5J, K). Companion chaetae with enlarged subdistal end, conspicuous microtubercles forming hood, resulting in dentate appearance, with thin distal mucro compressed laterally (Fig. 7K, L). Abdominal neuropodial chaetae narrowly hooded in both anterior and posteri- or rows (Fig. 7M). Abdominal uncini with about 10 rows of similar-sized teeth above main fang covering more than half length of main fang (Fig. 7N), neck shorter than breast, well-developed breast and short handles (0.5 times distance between breast and main fang, Fig. 5L). Pygidium as rounded rim around ventral anus (Fig. 7O), with scattered eyespots present on both sides, only visible in some specimens.</p> <p>Colour pattern: Brown pigmentation on bases of radioles and on groups of pigmented pinnules (Fig. 6A, D) in some specimens. Scattered pigment spots present along longitudinal axis of radioles (Fig. 6A, D). Some specimens with brown pigment on thorax, absent from ventral shields and tori (Fig. 6A–C). Spots present between neuro- and notopodial rami, superficially resembling interramal eyespots (Fig. 6B), faded in some specimens.</p> <p>Reproductive features: Gravid specimens with body lengths of 10–35 mm were found, with eggs in last thoracic and in abdominal segments.</p> <p>Genetic data: Sequences from two specimens from Western Australia and four from New South Wales show wide genetic variation, congruent with their geographical distribution, with the physically most distant specimens showing the largest genetic divergence (of up to 23.6% in cox1 and 10.2% in ITS sequences). Genetic distance in cox1 sequences to the other Parasabella species is 29.6–31.5% (Table 3) and 20.9–28.4% in ITS (Table 4). All members of this clade exclusively show the nucleotide sequence TGGA in positions 173–176 of the ITS alignment, amongst several scattered onenucleotide synapomorphies along the nuclear and mitochondrial fragments.</p> <p>Remarks: This species is easily distinguished from other congeners by the fleshy swellings on the dorsum of the first two chaetigers. Augener (1926: 247, fig. 18A, B) illustrated this very distinctive feature in his original description. However, variations have been found amongst Australian specimens, as some show the swelling as a continuous transverse ridge with a single large posterior-facing sinus and without the faecal groove and cilia running longitudinally across this structure. The two morphological conditions (continuous, or dual dorsal swelling across anterior thoracic segments) are not congruent with the two subclades that show maximum genetic divergence. PS26 (from New South Wales) is the only specimen included in the genetic analyses with a continuous transverse dorsal swelling whereas the rest of specimens (New South Wales and Western Australia) present the dual split structure across the dorsum.</p> <p>Parasabella aberrans was recorded in Australia, albeit as part of the material of Sabella porifera Grube, 1878, by Augener (1914) from Shark Bay in Western Australia, before he subsequently described it from Little Barrier Island in New Zealand (see Augener, 1926). Further collecting within the distribution range will determine if this species is broadly distributed but with great genetic population structure, or whether there has been a lack of gene flow between two populations from distant localities that can be interpreted as an indication of separate, closely related species that show no morphological variation (cryptic species).</p> <p>Type locality: Little Barrier Island, New Zealand, 55 m depth.</p> <p>Distribution: New Zealand, Australia (Queensland, New South Wales, South Australia, Western Australia; Fig. 1A).</p> <p>Ecological notes: The species is widespread in New Zealand but usually occurs as single individuals on wharf piles (G. Read, pers. comm.). It was reported in New Zealand Port surveys from 2005–2008 (Inglis et al., 2005, 2006, 2008). In Australia, it has been recorded not only in the fouling communities from wharf piles in port areas (Port Kembla, Eden, Botany Bay and Bunbury Harbour, see Appendix), but has also been collected from more pristine coastal and offshore environments such as Lizard Island in Queensland, Kangaroo Island in South Australia, and south of Jervis Bay, New South Wales, from the intertidal to 80 m depth. In future, genetic studies of New Zealand populations should also be included to evaluate the broad distribution range reported for the species to determine if this can be explained through natural means or if unintentional translocations could be responsible for such a wide distribution (not detected in this study).</p> <p>PARASABELLA SP. CF. P. AULACONOTA (VON</p></div> 	https://treatment.plazi.org/id/E41687B47E49FFBD9E27F967FAE9FA08	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Capa, María;Murray, Anna	Capa, María, Murray, Anna (2015): Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range. Zoological Journal of the Linnean Society 175 (4): 764-811, DOI: 10.1111/zoj.12308, URL: http://dx.doi.org/10.1111/zoj.12308
E41687B47E52FFB69E70FA70FDD8FB83.text	E41687B47E52FFB69E70FA70FDD8FB83.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Parasabella crassichaetae Capa & Murray 2015	<div><p>PARASABELLA CRASSICHAETAE SP. NOV. COMPLEX</p> <p>(FIGS 4E, 5E, R–T, 12, 13)</p> <p>Holotype: AM W.47145, New South Wales, Shellharbour, north-east of Bass Point, ‘ <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=150.9061&amp;materialsCitation.latitude=-34.593056" title="Search Plazi for locations around (long 150.9061/lat -34.593056)">The Humps’</a>, 34°35′35″S, 150°54′22″E, from orange sponge, 22.4 m depth, 4.v.2010, coll. R. T. Springthorpe, MI NSW 3956.</p> <p>Paratypes: AM W.47146 (6), same collection details as holotype.</p> <p>Additional material examined (see Appendix for details): Australia. Western Australia: Esperance (three), Albany (four), Outer Bunbury Harbour (two), Ningaloo Reef (many), Dampier Archipelago (nine); Northern Territory: Darwin Harbour (two); Queensland: Weipa (six), Cairns (six); New South Wales: Cook Islands (four), Byron Bay (two), Solitary Islands (eight), Coffs Harbour (two), Port Stephens (11), Port Jackson (12), Botany Bay area (16, including PS21, PS23, PS24, PS28), Shellharbour (one = PS03), Jervis Bay (one), Batemans Bay (six). USA. Hawaii: Oahu, Coconut Island (eight, including PS10, PS11, PS12).</p> <p>Comparative material examined: Holotype of Demonax leucaspis Kinberg, 1867, SMNH 575, Peru, east of Lima, San Lorenzo Island, 12°00′S, 077°00′W, collected by Eugenie Expedition 1851–1853, station 568–9. Holotype of Sabella albicans Johansson, 1922, UPSZTY 2304, Japan, Misaki, ‘Diver’ from Laminaria, S. Bock collection.</p> <p>Diagnosis: Radiolar eyes absent. Radioles supported by 6–10 rows of vacuolated cells near base. Thoracic ventral shields in contact with neuropodial tori. Inferior thoracic notochaetae type A, with hoods three times as wide as shaft, and up to three times as long as its maximum width. Thoracic uncini with mediumlength handles, and neck half of breast length.</p> <p>Description: Body 12.5 mm long, 1.7 mm wide; crown 4 mm long; Thorax with six chaetigers, and abdomen with 63, posterior end regenerating. Preserved holotype lacks colour on trunk, but diffuse brown pigmentation is present on collar, and crown has four pigment bands with radiolar pinnules also pigmented, as well as brown pigment spots groups of bars along radioles. Radiolar crown basal lobes as long as 1.5 times thoracic chaetigers, with nine pairs of radioles arranged in two semicircles. Radioles with outer margins quadrangular to round in cross-section (Fig. 13A, D) and each supported basally by eight vacuolated cells (Fig. 4E). Radiolar tips wide, tapering, bare for approximately twice length of longest pinnules (or equal to length of four thoracic segments). Radiolar flanges and eyes absent. Dorsal lips with radiolar appendages as long as five thoracic segments, each with single pinnular appendage. Posterior peristomial ring collar similar in length all around, completely covering base of crown, with rounded ventral lappets shorter than one thoracic segment (Fig. 13A, B) and rounded dorsal margins. Peristomial eyes present subdermally. Anterodorsal fleshy swelling absent. Thoracic ventral shields similar in length, twice as wide as long, in contact with thoracic tori. First ventral shield with slight incision in anterior margin and m-shaped. Collar chaetae elongate, narrowly hooded (Fig. 13E). Superior thoracic notochaetae elongate narrowly hooded (Fig. 13F); inferior thoracic chaetae broadly hooded (type A), and hood three times width of shaft and about three times as long as its maximum width (Figs 5E, 13F, G). Thoracic uncini with eight to ten rows of teeth over main fang, covering slightly over half length of main fang (Fig. 13H), with well-developed breast, reaching to the tip of main fang, neck half length of breast, and handle 1.5–2 times length of the distance between breast and main fang (Fig. 5R). Thoracic neuropodial companion chaetae with subdistal end enlarged, conspicuous microtubercles forming hood resulting in dentate appearance, and with thin distal mucro, compressed laterally (Fig. 13I). Abdominal neurochaetae narrowly hooded (Fig. 13J). Abdominal uncini with about eight rows of teeth over main fang, covering half length of main fang (Fig. 13K), neck shorter than breast, breast well developed and with medium-length handle, 1.5 times length of the distance between main fang and breast (Fig. 5S). Pygidium a rim with a ventral anus (Fig. 13L), several red eyespots on both sides.</p> <p>Variation: Specimens display variability for many features: size (4–22 mm length, 0.5–1.8 mm width), numbers of thoracic chaetigers (4–8), abdominal segments (ten to 63), number of radioles (5–12), and numbers of rows of vacuolated cells supporting radioles basally (six to ten). Dorsal radiolar appendages vary from 4–8 thoracic segments in length; pinnular appendages vary from 0–2 pairs. Collar completely covers base of crown in some specimens, but junction of peristomium and crown is laterally visible in some small specimens. Thoracic uncini vary in shape with handles one to two times length of the distance between breast and main fang, and 8–10 rows of teeth over main fang. Abdominal uncini have 6–10 rows of teeth over main fang and short- to medium-length handles (0.5–1.5 times length of the distance between main fang and breast; Fig. 5S, T). There is not much variability, however, in the shape of inferior thoracic chaetae – their width varies from 2–3 times width of shaft and three times as long as its maximum width. Some of this morphological variability is summarized in Table 5. Preserved specimens vary from possessing little colour pigment in radioles (a few spots) to three to four pigment bands in crown, with pigmented radiolar pinnules, and longitudinal bars of pigment embedded in rachis of radioles (Fig. 12A–C). Pygidial eyespots faded in some specimens. Tubes are tough and chitinous, with adherent sand particles, shell, and bryozoans.</p> <p>Reproductive features: Some specimens as small as 8 mm in body length contain eggs in abdominal segments.</p> <p>Genetic data: Within the definition of P. crassichaetae sp. nov. two subclades, well supported and significantly different, were recovered (Fig. 3B, C). The same haplotype was found for Australian specimens and a single mitochondrialsequence obtained from Hawaiian populations. Comparisons of nuclear fragments showed that divergence between clades is up to 10.6% (Table 4). One clade comprises specimens from Hawaii, Morphological features Distribution Specimens (Registration numbers)</p> <p>Abdominal uncini with WA NMVF108905*, NMVF108908*, AM W.21996, AM W.47144*, medium handle and around AM W.47148–9 ten rows of small teeth QLD AM W.36448*, AM W.4392, AM W.47178–80, AM W.47151 above main fang NSW AM W.47181*, AM W.31102, AM W.46677, AM W.31103 AM W.37028 (PS03), AM W.37044 (PS21), W.37046 (PS23), W.37047 (PS24), W.37049 (PS28) Hawaii AM W.37036 (PS12), AM W47183</p> <p>Abdominal uncini with short WA NMVF108906, AM W.36447, AM W.47150 handle and six to seven NT AM W.32579 (PS16), AM W.47147 rows of larger teeth above Hawaii AM W.37034 (PS10), AM W.37035 (PS11), AM W.37037 (PS13) main fang</p> <p>*Specimens with six to eight rows of vacuolated cells supporting the radioles basally.</p> <p>NSW, New South Wales; QLD, Queensland; NT, Northern Territory; WA, Western Australia.</p> <p>New South Wales, and the Northern Territory that differ by a maximum of 6.0% of their ITS sequences (New South Wales and Northern Territory specimens, not shown). Specimens belonging to this clade are characterized by sharing several diagnostic nucleotide blocks such as CTACCCCCTGT in the 334–344 nucleotide positions and the ATCTGCTCTGGGCGGTCCT in the 586– 584 nucleotide positions of the ITS alignment. The second clade, consisting of five specimens from three close localities in New South Wales, with only ITS fragments successfully sequenced, had the same haplotype with unique blocks, such as CTTCACTCTACCCCCTGT in the 327–377 nucleotide positions, ACGTCTGCCGGAC in the 356–368 nucleotide positions, and TGCAAGGAC CCGCCCCACATCTGCTCTGGGCGGTCCTCCTT in the 548–588 nucleotide positions in the ITS alignment.</p> <p>Remarks: Parasabella crassichaetae sp. nov. complex is characterized by exceptionally broad and short inferior thoracic chaetae with a thin distal tip, almost resembling paleae externally but with a shaft continuing through the hood and into the distal tip, a character that defines broadly hooded chaetae. This attribute is also shared by other congeneric species such as P. albicans, P. leucaspis, Parasabella langerhansi, Parasabella brevithoracica (Pillai, 1961), Parasabella pallida Moore, 1923, Parasabella saxicola (Grube, 1861), P. media, Parasabella tenuicollaris, P. tommasi, and Parasabella torulis (Table 2). Parasabella torulis is distinguished from the others by possessing thoracic ventral shields separated from neuropodial tori. All the other species have ventral shields in contact with neuropodial uncinial tori. Some of these species, such as P. media and P. leucaspis (Claparède, 1870; Knight-Jones, 1983; Perkins, 1984; Giangrande, 1994), differ from P. crassichaetae sp. nov. by the presence of radioles with more than 20 vacuolated cells in the bases of radioles. Parasabella leucaspis also possesses much shorter dorsal lips, only as long as one thoracic chaetiger compared with lengths more than four chaetigers in P. crassichaetae sp. nov. Both P. media and P. leucaspis also display variability in the shape of the inferior thoracic chaetae (Perkins, 1984), unlike P. crassichaetae sp. nov., which possesses only wide and short type A inferior thoracic chaetae.</p> <p>Parasabella langerhansi is distinguished from P. crassichaetae sp. nov. by having only four rows of vacuolated cells supporting the radioles (Knight-Jones, 1983). Of the remaining species having a similar number of vacuolated cells, P. tommasi possesses thoracic uncini with necks longer than breast and handles up to twice the length of distance between breast and main fang (Giangrande, 1994), while in P. crassichaetae sp. nov. necks are half the length of the breast, and handle is as long as the distance between breast and main fang or slightly longer. Parasabella brevithoracica has thoracic uncini with both necks and handles shorter than the new species (Knight-Jones, 1983; Table 2). Parasabella saxicola has longer inferior thoracic chaetae, and the thoracic uncini have shorter necks compared with P. crassichaetae sp. nov. (Knight-Jones, 1983). Parasabella albicans differs from P. crassichaetae sp. nov. in the relative length of the neck and breast of the thoracic uncini (Table 2; Johansson, 1922; Uchida, 1968) and a much shorter peristomial collar. Additionally, although we were unable to dissect thoracic inferior chaetae from the type specimen of P. albicans, these were reported by Imajima &amp; Hartman (1964) as being ‘non-spatulate’, and ‘short, broadly limbate’ by Uchida (1968: 608, Fig. 11), suggesting that they are dissimilar to the very broad type A chaetae of P. crassichaetae sp. nov. The species sharing the most features with P. crassichaetae sp. nov. is therefore P. pallida (Table 2). The differences between these species are the lengths of dorsal radiolar appendages, which are short in P. pallida (Perkins, 1984: 313; Fig. 15F) but as long as 4–8 thoracic chaetigers in P. crassichaetae sp. nov., as well as the apparent pigmentation pattern. Parasabella pallida was described without any pigment (Moore, 1923), although Perkins (1984) described nontype material of P. pallida as having ‘faint, light brown color spots on radioles’ – a distinct difference compared with specimens of P. crassichaetae sp. nov., which typically show pigment in the radioles (either transverse bands, spots, or longitudinal bars).</p> <p>Etymology: The name of the species refers to the broad inferior thoracic chaetae, a distinct trait when compared with other Australian congeners.</p> <p>Type locality: Shellharbour, New South Wales, Australia.</p> <p>Distribution: Around Australian coasts except Victoria and South Australia (Fig. 1B); Hawaii.</p> <p>Ecological notes: Specimens have been found in tropical and temperate environments in dead coral rubble, sponges, algae, and artificial surfaces in ports and harbours, from the intertidal to 25 m depth.</p></div> 	https://treatment.plazi.org/id/E41687B47E52FFB69E70FA70FDD8FB83	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Capa, María;Murray, Anna	Capa, María, Murray, Anna (2015): Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range. Zoological Journal of the Linnean Society 175 (4): 764-811, DOI: 10.1111/zoj.12308, URL: http://dx.doi.org/10.1111/zoj.12308
E41687B47E65FF899ECCFD2FFA17F8D0.text	E41687B47E65FF899ECCFD2FFA17F8D0.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Sabellomma Nogueira 2010	<div><p>GENUS SABELLOMMA NOGUEIRA ET AL., 2010, EMENDED</p> <p>Sabelloma Nogueira et al., 2010: 4.</p> <p>Type species: Parasabella minuta Treadwell, 1941.</p> <p>Diagnosis: Radiolar eyes irregularly distributed along outer margins, more numerous in areas with pigmented bands across radioles. Thoracic neuropodial companion chaetae with subdistal end enlarged, conspicuous microtubercles forming hood, resulting in dentate appearance, with thin distal mucro, generally flattened transversely.</p> <p>Description: Sabellids ranging in length from 3–30 mm (including crown); thorax with 4–8 chaetigers and abdomen with numerous chaetigers. Radiolar crown with four to 22 pairs of radioles arranged in two semicircular radiolar lobes, may be involuted dorsally. Radioles without basal membrane, stylodes, or radiolar flanges; outer margins with numerous, irregularly distributed eyespots, usually more numerous in areas with pigmented bands across radioles. Radioles supported by four to six rows of vacuolated cells at bases. Dorsal lips with radiolar appendages; pinnular appendages absent or present, one to two pairs when present, may be fused partially to dorsal lip; distally rounded ventral lips, continuing ventrally as parallel lamellae; ventral sacs present or absent. Peristomial eyespots present subdermally. Posterior peristomial ring collar only just covering branchial lobes; dorsal margins well separated from faecal groove; one pair of triangular, nonoverlapping ventral lappets. Inter-ramal eyespots present, especially evident in abdomen, but may be faded or absent. Collar chaetae elongate, narrowly hooded, arranged in two oblique rows, ventral row chaetae shorter than dorsal; remaining thoracic notopodia with superior arc of elongate, narrowly hooded chaetae, inferior chaetae as two rows of broadly hooded chaetae of type A. Thoracic neuropodia with avicular uncini about as long as high, 4–5 irregular rows of teeth above main fang, extending less than half the length of main fang, well-developed breast, and medium handles (as long as distance from breast to main fang). Thoracic neuropodial companion chaetae with subdistal end enlarged, conspicuous microtubercles forming hood, resulting in dentate appearance, and with thin distal mucro at right angles to shaft and flattened transversely. Abdominal neurochaetae narrowly hooded in both anterior and posterior rows. Abdominal notopodia with avicular uncini similar to thoracic or with shorter handles. Pygidium triangular, distally blunt; eyespots present.</p> <p>Remarks: The description of Sabellomma is here emended to incorporate the morphological differences observed in the new species and changes in the interpretation of the shape of the inferior thoracic chaetae. Sabellomma cupoculata sp. nov. lacks inter-ramal eyes, the dorsal margins of branchial lobes do not possess thickened ridges but instead radiolar lobes are involuted dorsally, peristomial eyes are present, companion chaetae with a very thin distal mucro are present, radioles are supported by six rows of vacuolated cells, and specimens with up to eight thoracic segments have been found; all different from previously described Sabellomma species (Nogueira et al., 2010). Moreover, in the original description of the genus, the inferior thoracic chaetae of members of Sabellomma were considered as paleate, but as the shaft runs through the hood, the chaetae should be considered as broadly hooded (Perkins, 1984; Fitzhugh, 1989; Capa et al., 2015). Sabellomma cupoculata sp. nov. lacks the ventral sacs described for the other three nominal species in the genus (Nogueira et al., 2010).</p> <p>The genus Sabellomma was erected to accommodate the type species previously considered as a Parasabella and subsequently as a Perkinsiana Knight-Jones, 1983 (Treadwell, 1941; Knight-Jones, 1983), from Brazil, together with two new additional species from Hawaii and the Caribbean, all characterized by the presence of unpaired, simple eyespots along the outer margins of radioles and possibly also inter-ramal spots (Nogueira et al., 2010). Both characters were considered as homoplastic because they have been reported in other sabellids (Nogueira et al., 2010). This type and arrangement of radiolar eyes is also described in P. microphthalma (Perkins, 1984) and in Pseudopotamilla cerasina (Grube, 1870). However, their presence in Parasabella microphthalma may be inaccurate and pigment spots mistakenly interpreted as eyespots (according to Nogueira et al., 2010), and Ps. cerasina, from the description (in which types were apparently not assigned) and from further notes on some other identified specimens, may actually be a Sabellomma and not Sabella, Potamilla, or Pseudopotamilla as previously suggested (Grube, 1870; Knight-Jones, Knight-Jones &amp; Ergen, 1991; Knight-Jones &amp; Perkins, 1998). These two species may have the same type of companion chaetae and radiolar eyes as members of Sabellomma. Moreover, although Ps. cerasina apparently bears dorsal radiolar flanges, similar to those present in all members of Pseudopotamilla (Knight-Jones &amp; Perkins, 1998), these could be in fact the basal, thickened ridges described in Sabellomma (Nogueira et al., 2010: 4). Conspicuous differences between Pseudopotamilla and Sabellomma, apart from the types of radiolar eyes, lie in the posterior peristomial ring collar dorsal margins, fused to the faecal groove in Pseudopotamilla and separated by a wide gap in Sabellomma; and the type of interior thoracic chaetae, paleate (that is, with the shaft not reaching the tip of the hood) in Pseudopotamilla, and broadly hooded (with shaft along the hood), in Sabellomma. If this synonymy is verified then the presence of simple eyespots along the outer margins of radioles will be the synapomorphy for the genus.</p> <p>SABELLOMMA CUPOCULATA SP. NOV. (FIGS 4H, 5H, Y, Z, 18, 19)</p> <p>Holotype: AM W.47193, Queensland, Lizard Island, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=145.55223&amp;materialsCitation.latitude=-14.826111" title="Search Plazi for locations around (long 145.55223/lat -14.826111)">High Rock</a>, 14°49′34″S, 145°33′08″E, coll. from coral rubble, 20.1 m depth, L. Avery, 11.ix.2010, CReefs Stn LI 10- 134, MI QLD 2233.</p> <p>Paratypes: AM W.47192 (1), same as holotype; AM W.47191 (4), <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=145.49194&amp;materialsCitation.latitude=-14.656388" title="Search Plazi for locations around (long 145.49194/lat -14.656388)">Lizard Island</a>, MacGillivray Reef (14°39′23″S, 145°29′31″E, coll. from coral rubble, 22 m, M. Capa &amp; P. Hutchings, 29.viii.2010, CReefs Stn LI 10- 028, MI QLD 2197.</p> <p>Additional material examined (see Appendix for details): Australia. Western Australia: Lewis Island (two), Legendre Island (one); Northern Territory: Darwin Harbour (one); Queensland: Torres Strait (one); Lizard Island, (nine), Heron Island (one).</p> <p>Diagnosis: Unpaired, simple eyespots present, randomly arranged along radiolar lateral margins. Radioles supported by six rows of vacuolated cells near base. Thoracic ventral shields in contact with neuropodial tori. Inferior thoracic notochaetae of type A, with hoods 1.5 times as wide as shaft, and as long as four to five times maximum width. Thoracic uncini with short handles, and neck slightly shorter than breast.</p> <p>Description: Holotype 7 mm long (excluding crown), 1 mm wide, radiolar crown 5 mm long. Thorax with seven chaetigers, abdomen with 47. Preserved holotype brown with white spots all over body (Fig. 18K). Radiolar crown with basal lobes as long as 1.5 thoracic segments, arranged in two semicircles (Figs 18C–D, H–J, 19A–D), slightly involuted dorsally. Radioles with rounded edges, flanges absent, with six rows of vacuolated cells supporting each radiole near base (Fig. 4H). Radiolar tips wide, tapering, bare for approximately length of pinnules. Cup-shaped radiolar eyes irregularly arranged along side margins of all radioles, except distally (Fig. 18E–G). Dorsal lips with radiolar appendages as long as three thoracic seg- ments (Figs 18H–J, 19D). One pinnular appendage fused to each dorsal lip, free for one-half to one-third of length, and joined to adjacent pinnule by membrane (Fig. 18I, J). Ventral lamellae present, ventral sacs absent (Fig. 18H). Posterior peristomial ring collar slightly increasing in length from dorsal to ventral side, covering junction of crown and peristomium, with low rounded ventral lappets, shorter than one thoracic segment (Figs 18A–D, H, K, L, 19A–D); dorsal margins with rounded edges (Figs 18D, 19D). Peristomial eyes present, subdermal. Inter-ramal eyes absent. Thoracic ventral shields four times wider than long, lateral margins in contact with neuropodial tori; first ventral shield m-shaped, twice as wide as long, with indentation along anterior margin. Collar chaetae elongate, narrowly hooded. Superior thoracic notochaetae elongate, broadly hooded (Fig. 19E); inferior thoracic notochaetae of remaining chaetigers with broadly hooded chaetae with progressively tapering distal tips (type A), with hoods 1.5 times width of shaft, and as long as 4–5 times maximum width (Figs 5H, 19E, F). Neuropodial tori similar in width along thorax, only slightly decreasing in width posteriorly. Uncini with 5–6 rows of teeth over main fang, covering just half length of main fang (Fig. 19G), well-developed breast, not reaching tip of main fang, neck longer than breast, handle short (shorter than the length of the distance between breast and main fang; Fig. 5Y). Thoracic neuropodial companion chaetae with subdistal end enlarged, conspicuous microtubercles forming hood, resulting in dentate appearance, and thin distal mucro flattened transversely, narrowing abruptly, tapering to long fine point (Fig. 19H–J). Abdominal neurochaetae narrowly hooded (Fig. 19K). Abdominal uncini with 5–6 rows of large teeth over main fang covering half length of main fang (Fig. 19L, M), uncinus proportionally higher than thoracic, with less defined breast and handle shorter than length of the distance between main fang and breast. Abdominal uncini decrease in size dorsoventrally within same torus. Pygidium a rim with ventral anus (Fig. 19N); red eyespots on both sides.</p> <p>Variation: Specimens range in length from 3 (AM W.20495) to 37 mm (AM W.37060), including crown, with widths of 0.3–2.3 mm. Thoracic chaetigers vary from 5–8. Collar varies in height from length of one to two thoracic segments – larger specimens (AM W.47189, AM W.37060) have higher collars with subquadrate dorsal margins, and 7–8 thoracic chaetigers, as well as more pronounced involution of dorsal radioles. Number of radioles varies from 5–22 pairs. Dorsal lips vary in length between 3–5 thoracic chaetigers. Ventral shields vary from 2–4 times wider than long, depending on contraction and type of fixation. Radiolar crown of live specimens with brownish base and some brown (∼five), white (∼seven), and purple (three to four) transverse bands irregularly arranged across radioles and pinnules (Fig. 18A–D). Colour patterns amongst specimens from Lizard (Fig. 18A) and Heron Islands (Fig. 18B–D) show some minor differences in number and width of colour bands in radiolar crown, but all specimens with brown radiolar base with white and bright purple transverse bands and small white spots over trunk. Some preserved specimens have little or no pigment remaining (Fig. 18H), whereas others remain brown (Fig. 18K). Pigment fades first from abdomen. Some specimens with little or no pigment in thorax after preservation may have small spots of pigment retained on ventral margin of the thoracic notopodial tori as well as ventral edges of neuropodial tori (Fig. 18H), unlikely to be eyes, and these appear to fade completely.</p> <p>Reproductive features: None of the examined specimens were gravid females but some nontype specimens, greater than 8 mm in length, possessed sperm in anterior abdominal segments, forming creamywhite dorsolateral patches.</p> <p>Genetic data: This species shows little genetic intraspecific variation (2.7 and 0.3%, comparing cox1 and ITS sequences, respectively). The specimens collected from Heron and Lizard Islands show the largest divergence, suggesting some population structure along the reported distribution range. The four specimens included in the analyses are characterized by several synapomorphies or barcodes, with some nucleotides scattered along the sequences and others, such as GCGCGTCCTGCGTTCCCTCCCCTCG in the 489– 513 nucleotide positions, configuring unique sequence blocks. The present phylogenetic hypothesis (Fig. 3C), after combination of the molecular and mitochondrial sequence data, suggests a sister-group relationship between Parasabella and Sabellomma, with maximum bootstrap support and genetic differences of over 25% in mitochondrial DNA fragments and over 40% in the nuclear fragment.</p> <p>Remarks: Sabellomma cupoculata sp. nov. resembles the other congeners, all described from the Western Atlantic, in the presence of irregularly distributed lensed eyes on outer margins of radioles, and the presence of companion chaetae with a transversely flattened distal mucro. The main differences between S. cupoculata sp. nov. and previously described species are: the shape of these companion chaetae (the mucro narrows abruptly and looks almost needle-like under light microscopy in S. cupoculata sp. nov., whereas the other three species have broader distal ends); radioles are supported by six vacuolated cells in S. cupoculata sp. nov. and four in the other three species; and the radiolar lobes lack a thickened ridge on their dorsal edge, present in the other Sabellomma species, but are instead slightly involuted dorsally in S. cupoculata sp. nov. Moreover, none of the species previously reported have bright purple bands in the crown when alive, whereas these are very conspicuous in the new Australian species.</p> <p>Sabellomma cupoculata sp. nov. resembles P. microphthalma in the type and arrangement of radiolar eyes in two irregular rows on outer sides of the radioles, if it can be verified that they are present in the latter species. However, these two species differ in the type of companion chaetae, which are representative of each of the two genera, and also in the</p> </div>	https://treatment.plazi.org/id/E41687B47E65FF899ECCFD2FFA17F8D0	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Capa, María;Murray, Anna	Capa, María, Murray, Anna (2015): Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range. Zoological Journal of the Linnean Society 175 (4): 764-811, DOI: 10.1111/zoj.12308, URL: http://dx.doi.org/10.1111/zoj.12308
E41687B47E60FF8B9DD7FA31FBB2FEEB.text	E41687B47E60FF8B9DD7FA31FBB2FEEB.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Parasabella AND	<div><p>MONOPHYLY OF PARASABELLA AND SABELLOMMA AND</p> <p>RELATIONSHIPS WITH OTHER SABELLIDS</p> <p>All species in Parasabella share the presence of companion chaetae with bulbous subdistal ends with a dentate appearance and a narrow tapered mucro arising from the centre and compressed laterally, which is unique in Sabellidae (Knight-Jones, 1983; Perkins, 1984; Fitzhugh, 1989; Capa et al., 2015). Monophyly of the genus was indicated herein (although weakly support- ed) for the first time, after analyses of molecular data. The monophyly of Sabellomma has already been assessed by Nogueira et al. (2010), after analyses of morphological data and considering a comprehensive number of sabellid terminals. It relies on the presence of unpaired eyes distributed along the radioles (Nogueira et al., 2010; and see explanation as to why some of the phylogenetic hypotheses tested recovered Sabellomma as paraphyletic).</p> <p>The phylogenetic hypothesis after combining nuclear and mitochondrial sequence data indicated a sistergroup relationship between Parasabella and Sabellomma. This result differs from a previous hypothesis that recovered Parasabella (as Demonax) as sister-group to Megalomma (Nogueira et al., 2010). These three genera, however, share several morphological features, all homoplastic. They bear broadly hooded inferior thoracic notochaetae (Fitzhugh, 1989; Capa &amp; Murray, 2009; Tovar-Hernández &amp; Carrera-Parra, 2011, and present study; see Nogueira et al., 2010 for a different interpretation in Sabellomma), also shared by members of Claviramus Fitzhugh, 2002, Euchoneira Licciano, Giangrande &amp; Gambi, 2009, Glomerula Nielsen, 1931 Potamilla Malmgren, 1866, and Terebrasabella Fitzhugh &amp; Rouse, 1999, amongst others (Nogueira et al., 2010; Capa et al., 2015). Moreover, Sabellomma and most members of Megalomma and Parasabella bear pinnular appendages associated with the dorsal lips, a feature that has also been reported in other sabellids, for example, Anamobaea Krøyer, 1856, Bispira Krøyer, 1856, Branchiomma Kölliker, 1858, Potamilla Malmgren, 1866, and Pseudopotamilla Buch, 1905 (Nogueira et al., 2010; Capa et al., 2015). The presence of a short thorax with fewer than the typical eight chaetigers has been considered as a characteristic of species of Sabellomma and some Parasabella (e.g. Knight-Jones, 1983; Perkins, 1984; Nogueira et al., 2010) but has also been reported in Megalomma (Knight-Jones, 1983; Tovar-Hernández &amp; Carrera-Parra, 2011) and many other sabellids (e.g. Knight-Jones &amp; Perkins, 1998; Nogueira &amp; Knight-Jones, 2002; Fitzhugh, 2003; Nogueira, López &amp; Rossi, 2004; Capa, Pons &amp; Hutchings, 2013). Members of Parasabella and Megalomma have also been reported with more than eight thoracic chaetigers (Knight-Jones, 1983; Knight-Jones &amp; Walker, 1985; Tovar-Hernández &amp; Carrera-Parra, 2011). But if an anomalous number of thoracic segments is indeed a consequence of imperfect regeneration after damage or reproduction by scissiparity, (Knight-Jones &amp; Bowden, 1984; Nogueira &amp; Knight-Jones, 2002; Fitzhugh, 2003; Nogueira et al., 2004; Capa, 2008), then intact specimens with the typical number of thoracic segments may also exist (even if not yet found) and thus this feature would not be diagnostic.</p> <p>At least some species of each of the three genera bear radiolar eyes, but if considered absent in P. microphthalma (as in Nogueira et al., 2010), their number and arrangement show large differences amongst members of the three genera. Megalomma is characterized by the presence of subdistal, sessile, and compound radiolar eyes, at least on the internal margin of the dorsal-most pair of radioles (Fitzhugh, 1989; Capa &amp; Murray, 2009; Tovar-Hernández &amp; Carrera-Parra, 2011), a synapomorphy for the genus. Sabellomma bears numerous, unpaired, randomly arranged eyespots along the outer margin of all radioles (Nogueira et al., 2010), a synapomorphy for the genus. Finally, Parasabella lacks eyes, except for the newly described species P. bioculata, which has paired simple eyespots on both sides of the distal radiolar tips of most radioles.</p> <p>Morphologically, Sabellomma and Megalomma share the shape of the companion chaetae, with a distal teardrop ‘membrane’, albeit very narrow in the hereindescribed S. cupoculata. By contrast, the mucro is at an angle in Parasabella, appearing as compressed laterally instead of flattened transversely. Some members of Sabellomma and Megalomma also have ventral sacs as a continuation of the ventral lips, whereas they have not been observed in Parasabella. The previously described three species of Sabellomma were characterized by the presence of inter-ramal eyespots, more conspicuous in the abdominal region (Nogueira et al., 2010), but this is a feature that has also been reported from some Megalomma species (Capa &amp; Murray, 2009; Tovar-Hernández &amp; Carrera-Parra, 2011) and is lacking (or completely faded) from S. cupoculata sp. nov.</p> <p>Megalomma and Parasabella resemble each other in the dentition of uncini as they generally have a large number of rows (over eight) with minute teeth all similar in size (Capa &amp; Murray, 2009; Tovar-Hernández &amp; Carrera-Parra, 2011; Figs 7K, L, 9J, 11H, 13I, 15H, 17E, F), whereas Sabellomma has both thoracic and abdominal uncini with fewer than eight rows and larger teeth (Nogueira et al., 2010; Fig. 19H–J). No distinct morphological features are shared between Parasabella and Sabellomma.</p> </div>	https://treatment.plazi.org/id/E41687B47E60FF8B9DD7FA31FBB2FEEB	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Capa, María;Murray, Anna	Capa, María, Murray, Anna (2015): Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range. Zoological Journal of the Linnean Society 175 (4): 764-811, DOI: 10.1111/zoj.12308, URL: http://dx.doi.org/10.1111/zoj.12308
E41687B47E68FF809DBDFC6BFE84FAB5.text	E41687B47E68FF809DBDFC6BFE84FAB5.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Parasabella bioculata Capa & Murray 2015	<div><p>PARASABELLA BIOCULATA SP. NOV.</p> <p>Additional material examined: Australia. Western Australia: AM W.46997 (one), Ningaloo Reef, north of Tantabiddi, lagoon off <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=113.99611&amp;materialsCitation.latitude=-21.86139" title="Search Plazi for locations around (long 113.99611/lat -21.86139)">Jurabi Point</a>, patch reef, 21°51′41″S, 113°59′46″E, reef rock with brown algae, 3.5 m, vi.2008. New South Wales: AM W.46840 (one), Port Stephens, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=152.14944&amp;materialsCitation.latitude=-32.715557" title="Search Plazi for locations around (long 152.14944/lat -32.715557)">Nelson Bay</a>, 32°42′56″S, 152°08′58″E, soft coral, 11.3 m, ii.2011. Timor-Leste. AM W.46835 (one), east of Atauro Island, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=125.61361&amp;materialsCitation.latitude=-8.241667" title="Search Plazi for locations around (long 125.61361/lat -8.241667)">Inner Reef</a>, reef slope, 8°14′30″S, 125°36′49″E, dead coral rubble and algae, 14 m, ix.2012.</p> </div>	https://treatment.plazi.org/id/E41687B47E68FF809DBDFC6BFE84FAB5	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Capa, María;Murray, Anna	Capa, María, Murray, Anna (2015): Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range. Zoological Journal of the Linnean Society 175 (4): 764-811, DOI: 10.1111/zoj.12308, URL: http://dx.doi.org/10.1111/zoj.12308
E41687B47E68FF839DE6FA99FDFBF9A0.text	E41687B47E68FF839DE6FA99FDFBF9A0.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Parasabella crassichaetae Capa & Murray 2015	<div><p>PARASABELLA CRASSICHAETAE SP. NOV. COMPLEX</p> <p>Additional material examined: Australia. Western Australia. NMV F.108905 (one), north-east end of Vancouver Peninsula, off <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=117.93667&amp;materialsCitation.latitude=-35.056667" title="Search Plazi for locations around (long 117.93667/lat -35.056667)">Albany</a>, 35°03′24″S, 117°56′12″E, red algae, 10 m, 8.iv.1984; NMV F.108906 (three), western end of Lucky Bay, near <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=122.23333&amp;materialsCitation.latitude=-33.983334" title="Search Plazi for locations around (long 122.23333/lat -33.983334)">Esperance</a>, 33°59′S, 122°14′E, sponges, red and coralline algae, 12.iv.1984; NMV F.108908 (three), north end of Little Beach, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=118.195&amp;materialsCitation.latitude=-34.973335" title="Search Plazi for locations around (long 118.195/lat -34.973335)">Two Peoples Bay</a>, 34°58′24″S, 118°11′42″E, tufted algae, 5–12 m, 5.iv.1984; AM W.47148 (five), <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=113.641106&amp;materialsCitation.latitude=-22.623611" title="Search Plazi for locations around (long 113.641106/lat -22.623611)">Ningaloo Reef</a>, 22°37′25″S, 113°38′28″E, coarse coral rubble, 7 m, 20.v.2009, CReefs Ningaloo 2009 Expedition, WA 1038; AM W.47150 (many), AM W.36447 (two on SEM pins), <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=113.711105&amp;materialsCitation.latitude=-22.755278" title="Search Plazi for locations around (long 113.711105/lat -22.755278)">Ningaloo Reef</a>, 22°45′19″S, 113°42′40″E, sponge and bryozoan, 17 m, 19.v.2009, CReefs Ningaloo 2009 Expedition, WA 1035; AM W.47144 (three), Dampier Archipelago, west of <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=116.79722&amp;materialsCitation.latitude=-20.484167" title="Search Plazi for locations around (long 116.79722/lat -20.484167)">Angel Island</a>, 20°29′03″S, 116°47′50″E, dead coral, 6 m, 25.vii.2000, WA 619; AM W.47149 (six), Dampier Archipelago, Enderby Island, 2 km west of <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=116.44528&amp;materialsCitation.latitude=-20.618334" title="Search Plazi for locations around (long 116.44528/lat -20.618334)">Rocky Head</a>, 20°37′06″S, 116°26′43″E, dead coral, 14 m, 3.viii.2000, WA 637; AM W.21996 (two), outer <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=115.64305&amp;materialsCitation.latitude=-33.306942" title="Search Plazi for locations around (long 115.64305/lat -33.306942)">Bunbury Harbour</a>, 33°18′25″S, 115°38′35″E, 10.1 m, 27.iii.1993. Northern Territory. AM W.32579 (one = PS16), Darwin, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=130.83333&amp;materialsCitation.latitude=-12.45" title="Search Plazi for locations around (long 130.83333/lat -12.45)">East Point Reef</a>, 12°27′S, 130°50′E, intertidal, 17.ix.2005; AM W.36298 (one on SEM stub), Darwin Harbour, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=130.76666&amp;materialsCitation.latitude=-12.4372225" title="Search Plazi for locations around (long 130.76666/lat -12.4372225)">West Point</a>, 12°26′14″S, 130°46′E, coral rubble, sponges, and algae, 6–8 m, 17.vii.1993, NT 324; AM W.47147 (one), Darwin Harbour, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=130.8&amp;materialsCitation.latitude=-12.5" title="Search Plazi for locations around (long 130.8/lat -12.5)">Weed Reef</a>, 12°30′S, 130°48′E, coral rubble, 4 m, 6.vii.1993, NT 348. Queensland. AM W.47151 (one), Weipa, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=141.95&amp;materialsCitation.latitude=-12.666667" title="Search Plazi for locations around (long 141.95/lat -12.666667)">Evans Landing Wharf</a>, 12°40′S, 141°57′E, x.1999, scraping from wharf piles, ‘P1014’, CRIMP QLD Ports Survey; AM W.47177 (one), Weipa, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=141.95&amp;materialsCitation.latitude=-12.666667" title="Search Plazi for locations around (long 141.95/lat -12.666667)">Evans Landing Wharf</a>, 12°40′S, 141°57′E, x.1999, benthic grab, ‘P973’, CRIMP QLD Ports Survey; AM W.36448 (one, plus one on SEM pin), <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=141.95&amp;materialsCitation.latitude=-12.666667" title="Search Plazi for locations around (long 141.95/lat -12.666667)">Weipa</a>, Humbug Point Wharf, 12°40′S, 141°57′E, x.1999, ‘P862’, CRIMP QLD Ports Survey; AM W.47152 (one), Weipa, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=141.95&amp;materialsCitation.latitude=-12.666667" title="Search Plazi for locations around (long 141.95/lat -12.666667)">Lorim Point Wharf</a>, 12°40′S, 141°57′E, x.1999, scraping from wharf piles, ‘P962’, CRIMP QLD Ports Survey; AM W.47178 (one), Weipa, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=141.95&amp;materialsCitation.latitude=-12.666667" title="Search Plazi for locations around (long 141.95/lat -12.666667)">Evans Landing Wharf</a>, 12°40′S, 141°57′E, x.1999, ‘P1020’, CRIMP QLD Ports Survey; AM W.47179 (five), Cairns, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=145.81667&amp;materialsCitation.latitude=-16.866667" title="Search Plazi for locations around (long 145.81667/lat -16.866667)">Wharf</a> 12, 16°52′S, 145°49′E, 20.xi.2001, ‘P3207’, CRIMP QLD Ports Survey; AM W.47180 (one), Cairns, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=145.81667&amp;materialsCitation.latitude=-16.866667" title="Search Plazi for locations around (long 145.81667/lat -16.866667)">Wharf</a> 1, 16°52′S, 145°49′E, 18.xi.2001, shrimp trap, ‘P3024’, CRIMP QLD Ports Survey. New South Wales. W25992 (one), South Ledge, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=153.57722&amp;materialsCitation.latitude=-28.194166" title="Search Plazi for locations around (long 153.57722/lat -28.194166)">Cook Island</a>, 28°11′39″S, 153°34′38″E, colonial ascidian, 9.vi.1993; W25993 (three), South Ledge, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=153.57722&amp;materialsCitation.latitude=-28.194166" title="Search Plazi for locations around (long 153.57722/lat -28.194166)">Cook Island</a>, 28°11′39″S, 153°34′38″E, frilly bryozoan, 9.vi.1993; W25984 (one), Byron Bay, 100 m north-west of <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=153.63&amp;materialsCitation.latitude=-28.613335" title="Search Plazi for locations around (long 153.63/lat -28.613335)">Julian Rocks</a>, 28°36′48″S, 153°37′48″E, rock with finger sponge, 03.iii.1992; W25985 (one), Byron Bay, 100 m northwest of <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=153.63&amp;materialsCitation.latitude=-28.613335" title="Search Plazi for locations around (long 153.63/lat -28.613335)">Julian Rocks</a>, 28°36′48″S, 153°37′48″E, shelly sand amongst turf on top of rocks, 4.iii.1992; W25986 (one), 100 m north-west of <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=153.18001&amp;materialsCitation.latitude=-30.233334" title="Search Plazi for locations around (long 153.18001/lat -30.233334)">Split Solitary Island</a>, 30°14′S, 153°10′48″E, encrusting algae and ascidians, 7.iii.1992; W25987 (one), 100 m north-west of <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=153.18001&amp;materialsCitation.latitude=-30.233334" title="Search Plazi for locations around (long 153.18001/lat -30.233334)">Split Solitary Island</a>, 30°14′S, 153 10′48″E, brown algae, 7.iii.1992; W25990 (one), Solitary Islands, 200 m north of <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=153.155&amp;materialsCitation.latitude=-30.314999" title="Search Plazi for locations around (long 153.155/lat -30.314999)">Korffs Islet</a>, 30°18′54″S, 153°09′18″E, mixed sponges, 22.vi.1992; W25991 (one), Solitary Islands, 100 m north of Korffs (<a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=153.155&amp;materialsCitation.latitude=-30.316668" title="Search Plazi for locations around (long 153.155/lat -30.316668)">Pig</a>) <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=153.155&amp;materialsCitation.latitude=-30.316668" title="Search Plazi for locations around (long 153.155/lat -30.316668)">Islet</a>, 30°19′S, 153°09′18″E, Ecklonia holdfasts, 26.vi.1992; W25988 (one), Coff’s Harbour, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=153.14166&amp;materialsCitation.latitude=-30.306665" title="Search Plazi for locations around (long 153.14166/lat -30.306665)">Coff’s Harbour Jetty</a>, 30°18′24″S, 153°08′30″E, orange sponge on jetty pilings, 9.iii.1992; W25989 (one), Coff’s Harbour, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=153.14166&amp;materialsCitation.latitude=-30.306665" title="Search Plazi for locations around (long 153.14166/lat -30.306665)">Coff’s Harbour Jetty</a>, 30°18′24″S, 153°08′30″E, finger sponge on jetty pilings, 9.iii.1992; AM W.32572 (one) Port Stephens, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=152.15&amp;materialsCitation.latitude=-32.71611" title="Search Plazi for locations around (long 152.15/lat -32.71611)">Nelson Bay</a> marina, 32°42′58″S, 152°09′00″E, 14.iii.2006, brown algae, 0.1 m, NSW 3058; AM W.47181 (ten), south of <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=152.19305&amp;materialsCitation.latitude=-32.750557" title="Search Plazi for locations around (long 152.19305/lat -32.750557)">Point Stephens Lighthouse</a>, 32°45′02″S, 152°11′35″E, from small brown cup sponge, 16 m, 31.v.1998, NSW 1492; AM W.27830–32 (nine), Port Jackson, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=151.22888&amp;materialsCitation.latitude=-33.86333" title="Search Plazi for locations around (long 151.22888/lat -33.86333)">Garden Island</a>, 33°51′48″S, 151°13′44″E, scrapings from jetty piles, 0.5–5 m, 21.v.2001, Sydney Ports Survey; AM W.37037 (one = PS13), Port Jackson, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=151.18333&amp;materialsCitation.latitude=-33.863052" title="Search Plazi for locations around (long 151.18333/lat -33.863052)">White Bay</a> Berth 3, 33°51′47″S, 151°11′00″E, scrapings from wharf piles, 11.8 m, 5.iii.2009, MI NSW 3399; AM W.27835 (one) Port Jackson, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=151.19028&amp;materialsCitation.latitude=-33.86111" title="Search Plazi for locations around (long 151.19028/lat -33.86111)">White Bay</a>, 33°51′40″S, 151°11′25″E, scrapings from wooden piles, 7 m, 18.iv.2001, Sydney Ports Survey; AM W.47184 (one), Port Jackson, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=151.18639&amp;materialsCitation.latitude=-33.866386" title="Search Plazi for locations around (long 151.18639/lat -33.866386)">Glebe Island</a> east, 33°51′59″S, 151°11′11″E, scrapings from cement facing, 3 m, 18.iv.2001, Sydney Ports Survey; AM W.37044 (four in 95% ethanol, one of which = PS21), north-east of Kurnell, ‘ <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=151.23082&amp;materialsCitation.latitude=-34.009167" title="Search Plazi for locations around (long 151.23082/lat -34.009167)">Anchor Reef’</a>, 34°00′33″S, 151°13′51″E, rock scrapings, 17.8 m, 16.iii.2009, MI NSW 3423; AM W.37049 (one in 95% ethanol = PS28), Jolong Reef, approximately 700 m north-east of <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=151.25389&amp;materialsCitation.latitude=-33.996666" title="Search Plazi for locations around (long 151.25389/lat -33.996666)">Cape Banks</a>, 33°59′48″S, 151°15′14″E, from sediment on rock, 20.5 m, 21.vii.2009, MI NSW 3642; AM W.37046 (one in 95% ethanol = PS23), same locality and date, sponges, 22.5 m, MI NSW 3645; AM W.37047 (one in 95% ethanol = PS24), from same sample, MI NSW 3645; AM W.46708 (two in 95% ethanol), Botany Bay, east of <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=151.22305&amp;materialsCitation.latitude=-34.183613" title="Search Plazi for locations around (long 151.22305/lat -34.183613)">Inscription Point</a>, 34°11′01″S, 151°13′23″E, tube of Sabella spallanzanii on rock, 12 m, 6.iii.2012, MI NSW 4093; AM W.43270 (&gt; five in 95% ethanol), Botany Bay, off <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=151.22499&amp;materialsCitation.latitude=-34.002224" title="Search Plazi for locations around (long 151.22499/lat -34.002224)">Inscription Point</a>, 34°00′08″S, 151°13′30″E, scraping from rock, 11 m, 28.v.2013, MI NSW 4152; AM W.37028 (one = PS03), Shellharbour, north-east of Bass Point, ‘ <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=150.9061&amp;materialsCitation.latitude=-34.593056" title="Search Plazi for locations around (long 150.9061/lat -34.593056)">The Humps’</a>, 34°35′35″S, 150°54′22″E, from orange sponge, 22.4 m, 4.v.2010, MI NSW 3956; W25994 (one), east side of Plantation Point, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=150.69333&amp;materialsCitation.latitude=-35.075" title="Search Plazi for locations around (long 150.69333/lat -35.075)">Jervis Bay</a>, 35°04′30″S, 150°41′36″E, foliose coralline algae on rock platform, high intertidal, 27.vi.1981, NSW 41; AM W.47185 (one), north of Batemans Bay, north-west side of <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=150.4161&amp;materialsCitation.latitude=-35.5275" title="Search Plazi for locations around (long 150.4161/lat -35.5275)">Brush Island</a>, 35°31′39″S, 150°24′58″E, from Caulerpa algae, 12– 14 m, 9.ii.2003, NSW 2031; AM W.31103 (two, one on SEM stub), west side of Wasp Island, north of <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=150.30806&amp;materialsCitation.latitude=-35.667225" title="Search Plazi for locations around (long 150.30806/lat -35.667225)">Batemans Bay</a>, 35°40′02″S, 150°18′29″E, from alga Peyssonelia novae-hollandiae, 16 m, 10.ii.2003, NSW 2047; AM W.31102 (three), south of Batemans Bay, north of <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=150.23611&amp;materialsCitation.latitude=-35.83361" title="Search Plazi for locations around (long 150.23611/lat -35.83361)">Burrewarra Point</a>, east wall, 35°50′01″S, 150°14′10″E, from alga Peyssonelia novae-hollandiae, 25 m, 25.x.2002, NSW 1985.</p> <p>USA. Hawaii. AM W.37034 (one = PS10), AM W.37035 (one = PS11), AM W.37036 (one = PS12), AM W.47183 (five), Oahu, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-157.96194&amp;materialsCitation.latitude=21.43" title="Search Plazi for locations around (long -157.96194/lat 21.43)">Coconut Island</a>, 21°25′48″N, 157°57′43″W, 0.5 m, intertidal epifauna, 4.xi.2008.</p> </div>	https://treatment.plazi.org/id/E41687B47E68FF839DE6FA99FDFBF9A0	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Capa, María;Murray, Anna	Capa, María, Murray, Anna (2015): Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range. Zoological Journal of the Linnean Society 175 (4): 764-811, DOI: 10.1111/zoj.12308, URL: http://dx.doi.org/10.1111/zoj.12308
E41687B47E6BFF829EDBFA31FB49FE2D.text	E41687B47E6BFF829EDBFA31FB49FE2D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Sabellomma cupoculata Capa & Murray 2015	<div><p>SABELLOMMA CUPOCULATA SP. NOV.</p> <p>Additional material examined: Australia. Western Australia: AM W.47189 (two), south-west tip of <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=116.59528&amp;materialsCitation.latitude=-20.604168" title="Search Plazi for locations around (long 116.59528/lat -20.604168)">West Lewis Island</a>, 20°36′15″S, 116°35′43″E, gravel, 10 m, 27.vii.2000, WA 623; AM W.47190 (one), Dampier Archipelago, Legendre Island, 1 km north-east of <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=116.84278&amp;materialsCitation.latitude=-20.354445" title="Search Plazi for locations around (long 116.84278/lat -20.354445)">Cape Legendre</a>, 20°21′16″S, 116°50′34″E, under small boulders, 27 m, 6.viii.2000, WA 644. Northern Territory: AM W.47188 (one), Darwin Harbour, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=130.88666&amp;materialsCitation.latitude=-12.496667" title="Search Plazi for locations around (long 130.88666/lat -12.496667)">North Shell Island</a>, 12°29′48″S, 130°53′12″E, sponges and algae in coral rubble, 5–8 m, 16.vii.1993, NT 346. Queensland: AM W.30495 (one), Torres Strait, Prince of Wales Island, bommies northwest of <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=142.10056&amp;materialsCitation.latitude=-10.685555" title="Search Plazi for locations around (long 142.10056/lat -10.685555)">Bamfield Point</a>, 10°41′08″S, 142°06′02″E, live coral, 3 m, 3.x.2006, QLD 1927; MAGNT W23104 (five, one on SEM pin = AM W.39545.001), Lizard Island, off <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=145.45332&amp;materialsCitation.latitude=-14.6455555" title="Search Plazi for locations around (long 145.45332/lat -14.6455555)">North Head</a>, 14°38′44″S, 145°27′12″E, 12 m, 14.iv.2008, CReefs Stn CGLI –025; AM W.37061 (one = PS 41), Lizard Island, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=145.49194&amp;materialsCitation.latitude=-14.656388" title="Search Plazi for locations around (long 145.49194/lat -14.656388)">MacGillivray Reef</a>, 14°39′23″S, 145°29′31″E, coral rubble, 22 m, 29.viii.2010, MI QLD 2197, CReefs Stn LI10–028; AM W.37029–37030 (two, one = PS 06), Lizard Island, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=145.55223&amp;materialsCitation.latitude=-14.826111" title="Search Plazi for locations around (long 145.55223/lat -14.826111)">High Rock</a>, 14°49′34″S, 145°33′08″E, coral rubble, 20.1 m, 11.ix.2010, MI QLD 2233, CReefs Stn LI10–134; AM W.37057 (one = PS 37), <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=145.47276&amp;materialsCitation.latitude=-14.656944" title="Search Plazi for locations around (long 145.47276/lat -14.656944)">MacGillivray Reef</a>, deep reef slope, 14°39′25″S, 145°28′22″E, coral rubble, 30 m, 4.ix.2010, CReefs Stn LI 10–073; AM W.37060 (one = PS 40), Heron Island, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=151.03389&amp;materialsCitation.latitude=-23.432499" title="Search Plazi for locations around (long 151.03389/lat -23.432499)">Sykes</a> reef, 23°25′57″S, 151°02′02″E, coarse coral rubble, 30 m, 14.xi.2009, MI QLD 2073, CReefs.</p> </div>	https://treatment.plazi.org/id/E41687B47E6BFF829EDBFA31FB49FE2D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Capa, María;Murray, Anna	Capa, María, Murray, Anna (2015): Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range. Zoological Journal of the Linnean Society 175 (4): 764-811, DOI: 10.1111/zoj.12308, URL: http://dx.doi.org/10.1111/zoj.12308
