identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
983E1C4EC61A4DC33B96DE5C80773F89.text	983E1C4EC61A4DC33B96DE5C80773F89.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Heteranassa Smith 1899	<html xmlns:mods="http://www.loc.gov/mods/v3">
    <body>
        <div>
            <p>Taxon classification Animalia Lepidoptera Erebidae</p>
            <p> Heteranassa Smith, 1899</p>
            <p>Type species.</p>
            <p> Homoptera mima Harvey, by subsequent designation by Nye 1975. </p>
            <p>Taxonomy.</p>
            <p> Heteranassa Smith, 1899: 105; Smith et al. 1903: 5; Barnes et al. 1917: 86; McDunnough 1938: 121; Kimball 1965: 130; Nye 1975: 239; Franclemont and Todd 1983; Poole 1989; Poole and Gentili 1996; Mustelin 2006: 7; Lafontaine and Schmidt 2010: 37; Zahiri et al. 2012: 118. </p>
            <p>Diagnosis.</p>
            <p> Heteranassa mima is now the only valid species in the genus. The genus and species can be distinguished from similar genera by the absence of  spine–like setae on the mesothoracic tibia (Fig. 2) (Smith 1899). The male genitalia (Figs 3, 4) serve to distinguish  Heteranassa from other genera of  Erebinae in the southwestern United States by the presence of a setose, membranous costal region of valves (Fig. 3) (Franclemont 1986), and a  “D” shaped, sclerotized saccular process connecting to the saccular region of the valves (Fig. 3). The female genitalia (Fig. 5) does not differ dramatically from other  Omopterini . Male antennae fasciculate (Fig. 6), female antennae filiform. The proboscis (Fig. 7) is well-developed. </p>
            <p> Specimens of  Eubolina impartialis Harvey,  Matigramma species,  Acritogramma metaleuca (Hampson),  Toxonprucha species and  Coxina species are frequently misidentified as  Heteranassa . Of these,  Acritogramma metaleuca is the most similar to  Heteranassa (Franclemont 1986).  Acritogramma metaleuca can be most easily distinguished by the presence of spine-like setae on the mesothoracic tibia, and there are also subtle differences in wing pattern (Franclemont 1986).  Acritogramma metaleuca has no brown lines or shading on the forewing, and the discal spot is distinctly lunulate.  Eubolina impartialis is similar to both  Heteranassa and  Acritogramma metaleuca but has a brownish ground color on the hindwings, instead of grayish white, and spine-like setae on the mesothoracic tibia. From southern Texas into Mexico,  Heteranassa may be confused with  co–occurring Coxina species. This genus shows affinities to  Heteranassa in forewing pattern and genitalia, but a lighter hindwing ground color serves to separate  Heteranassa . Additionally, similarities in wing pattern and genital morphology suggest a relationship to the Caribbean and South American genus  Elousa Walker. The ranges of  Heteranassa and  Elousa may overlap in southern Mexico.  Elousa can be separated from  Heteranassa by its smaller size, and the light gray to white mottling of the forewings.  Toxonprucha species are generally smaller than  Heteranassa , and they possess hindwings with a darker ground color and more distinct patterning than those of  Heteranassa . A key to  Heteranassa and similar species is provided below. </p>
            <p>Taxonomic history.</p>
            <p> Harvey (1876) described  Homoptera mima from a single female from Texas, listing Belfrage as the source of the specimen. He referred the species to the genus  Homoptera Guenée , but did not mention any characters used to determine generic placement. Grote (1882), in a checklist, moved  Heteranassa mima to the genus  Eubolina Harvey, 1875, again without any mention of characters used. Smith (1899) described  Heteranassa fraterna and  Heteranassa minor and placed these species in the genus  Campometra Guenée , 1852.  Campometra fraterna was described from a series of six  lightly–marked specimens collected in Death Valley, California., and a single specimen from Catalina Springs, Arizona.  Campometra minor was described from a series of five small female specimens collected in Arizona. Smith described these two species as new based on differences in size, coloration, and patterning. Smith (1899) proposed the genus  Heteranassa to circumscribe  Heteranassa mima ,  Heteranassa fraterna , and  Heteranassa minor based on the absence of  spine -like setae on the mesothoracic tibia in these three species. Smith (1899) wrote, "I prefer leaving them with  Campometra temporarily, until all of the allied genera can be carefully studied, but suggest the term  Heternassa in case generic separation seems desirable." These three species were formally referred to  Heteranassa by Smith et al. (1903). Todd (1982) reviewed  Smith’s type series and designated lectotypes for  Heteranassa minor and  Heteranassa fraterna . The pupa of  Heteranassa was first described by Comstock (1955), and Crumb (1956) gave a description of the larva of  Heteranassa . </p>
            <p> In his study of southern California  Noctuoidea , Mustelin (2006) determined  Heteranassa minor to be a synonym of  Heteranassa fraterna . He found no differences in genital morphology between the types of  Heteranassa fraterna and  Heteranassa minor (Mustelin 2006). Mustelin (2006) did not examine the type specimen of  Heteranassa mima , located in the Natural History Museum, London. </p>
            <p>Description.</p>
            <p> Adult male (Fig. 8): Head: front smooth scaled, vertex scales erect, elongate; labial palpi elongate, erect, three segments; area of frons behind labial palpi unscaled with domed center; antennae (Fig. 6) fasciculate, smooth scaled, conspicuous sensory setae on ventral surface; eyes smooth; proboscis well developed, coiled between labial palpi (Fig. 7). Thorax: smooth scaled dorsum; ventrally lighter; thick tuft of hairs arising below base of forewing. Legs: smooth scaled; prothoracic tibia with spatulate epiphysis, flattened hairs on ventral surface; mesothoracic tibia with thick tuft of scales, expanded distally, pair of spurs at distal end, spine-like setae absent; metathoracic tibia with pair of spurs mesially and at distal end; tarsi with three rows of spine-like setae. Forewing: 9.7-14.9 mm; antemedial line pointed apically on anal vein; medial line black, pointed mesially on radial, cubital, and anal veins; postmedial line black, outlining apical half of discal area; subterminal line brown, jagged, bordering lighter colored terminal area; terminal line scalloped outwardly at termini of veins, apical margin traced in lighter coloration; fringe scalloped apically at termini of veins; reniform spot markings range from white spot (Fig. 9), to thin white vertical dash (Fig. 10), to a barely visible dash (Figs 8, 11), or black (Fig. 12). Hind wing: ground color gray-white, darker shading distally; terminal line black, scalloped apically at termini of veins; fringe light gray, with dark shading between termini of M3 and CuA2 and between termini of 2A and 3A. Abdomen: segments 1 through 4 tufted dorsally. Genitalia (Figs 3, 4): Tegumen slightly excurved dorsally, lateral processes at distal end of each arm, process dorsally at distal end; uncus sparsely setose, curved, pointed; tuba analis membranous; scaphium sclerotized, tuba analis opening apically; juxta lightly sclerotized, excurved ventrally; transtilla membranous; vinculum U-shaped, mesial margin heavily sclerotized towards articulation with tegumen, widened in middle; valves conjoined basally, sclerotized basally, membranous distally; sacculus sclerotized; saccular process extended dorsally connected to membranous costal region; sclerotized part of valve with  finger–like extension half distance from base; base of costa with a looped sclerite, connected to saccular process; aedeagus curved, narrowed apically, rounded anteriorly, dorsally sclerotized, ventrally membranous, dorsal surfaces undulating apically, apex pointed; ductus seminalis on ventral side; vesica membranous, without setae or cornuti, not elongated,four diverticula: one subbasal, two medial, and one apical. Adult Female: (Figs 7-10, 12) forewing length 11.0-16.7 mm. Exterior similar to male, except antennae filiform, mesothoracic tibiae not expanded distally. Genitalia: (Fig. 5)  papilla analis membranous, rounded apically, setae stout, variable length; posterior apophysis extending just beyond anterior margin of 8th abdominal segment, apically curved inwards; anterior apophysis ca. 0.5  × length of posterior apophysis, paddle-shaped apex; anal tube: interior lining of anal tube with many rows of minute spines directed anteriorly on dorsal wall, ventral wall densely covered with shark-tooth-like tubercles; intersegmen  tal membrane with many shark-tooth-like tubercles; 8th abdominal segment ringed with stout setae caudally; ostium bursae lightly sclerotized; antrum circular, membranous; ductus bursae reduced, membranous; corpus bursae elongate, membranous. </p>
            <p>Eggs. Dark bluish gray, ~1/2 mm diameter; captured females laid eggs singly or in groups of less than five in crevices of host plant bark, or singly on sides of enclosing container.</p>
            <p> Larvae . Variable in color; eggs developed into adults within five weeks; observations are consistent with Comstock (1955) and Crumb (1956). Larvae pupated before high-quality photographs could be taken. </p>
        </div>
    </body>
</html>
	https://treatment.plazi.org/id/983E1C4EC61A4DC33B96DE5C80773F89	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Homziak, Nicholas;Hopkins, Heidi;Miller, Kelly B.	Homziak, Nicholas, Hopkins, Heidi, Miller, Kelly B. (2015): Revision of the genus Heteranassa Smith, 1899 (Lepidoptera, Erebidae, Omopterini). ZooKeys 527: 31-49, DOI: http://dx.doi.org/10.3897/zookeys.527.8771, URL: http://dx.doi.org/10.3897/zookeys.527.8771
9666720E5CC927D8BFE7B751730B15A0.text	9666720E5CC927D8BFE7B751730B15A0.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Heteranassa mima (Harvey 1876) Harvey 1876	<html xmlns:mods="http://www.loc.gov/mods/v3">
    <body>
        <div>
            <p>Taxon classification Animalia Lepidoptera Erebidae</p>
            <p> Heteranassa mima (Harvey, 1876)</p>
            <p> Homoptera mima Harvey, 1876: 155-156. </p>
            <p> Eubolina mima ; Grote 1882: 42; Smith 1891: 63; 1893: 372. </p>
            <p> Campometra mima ; Smith 1899: 104-105; Dyar 1903: 237. </p>
            <p> Elousa mima ; Draudt and Gaede (in Seitz) 1923: 478. </p>
            <p> Heteranassa mima (Harvey, 1876); Smith et al. 1903: 5; Barnes et al. 1917: 86; McDunnough 1938: 121; Kimball 1965: 130; Franclemont and Todd 1983; Poole 1989, 1996; Mustelin 2006: 7; Lafontaine and Schmidt 2010: 37. </p>
            <p> Campometra fraterna Smith, 1899: 104, syn. n.; Dyar 1903: 236. </p>
            <p> Heteranassa fraterna (Smith, 1899); Smith et al. 1903: 5; Barnes et al. 1917: 86; McDunnough 1938: 121; Kimball 1965: 130; Franclemont and Todd 1983; Poole 1989, 1996; Mustelin 2006: 7; Lafontaine and Schmidt 2010: 37. </p>
            <p> Elousa fraterna ; Draudt and Gaede (in Seitz) 1923: 478. </p>
            <p> Campometra minor Smith, 1899: 104-105; Dyar 1903: 236. </p>
            <p> Elousa minor : Draudt &amp; Gaede (in Seitz) 1923: 478. </p>
            <p> Heteranassa minor (Smith, 1899), syn. n.; Smith et al. 1903: 5; Barnes et al. 1917: 86; McDunnough 1938: 121; Kimball 1965: 130; Franclemont and Todd 1983; Poole 1989, 1996; Mustelin 2006: 7. </p>
            <p>Diagnosis.</p>
            <p>This is the only species in the genus and can be diagnosed with the generic combination (see above).</p>
            <p>Type material.</p>
            <p> Heteranassa mima (Harvey, 1875). Holotype, (Fig. 13) ♀ in the Natural History Museum, London (BMNH) labeled: "Homoptera mima, type, Harvey, Holotype, 15/9, 73." The specimen and associated labels were examined through high-resolution photographs provided by the BMNH. Type locality: Texas [USA] </p>
            <p> Heteranassa fraterna (Smith, 1899). Lectotype (Fig. 14) ♀ in USNM, designated by Todd (1982), labeled: "Death Valley, April '91 K., 677, 115 [circled], ♀ genitalia on slide, Sept. 21, 1938, J.F.G.C. #2035, Type No. 4313 U.S.N.M., Lectotype,  Campometra fraterna , Smith, Genitalia slide U.S.N.M. 40478,  Campometra fraterna , ♀ Cotype, Smith" Type locality: Death Valley [California, USA] </p>
            <p> Heteranassa minor (Smith, 1899). Lectotype, (Fig. 15) ♀ in USNM labeled: "  Campometra minor , ♀ type, Smith, Lectotype,  Campometra minor , Smith, ♀ genitalia on slide, Sept. 21, 1938, J.F.G.C. #2035, Genitalia slide, U.S.N.M. 40477, Type No. 4314 U.S.N.M., U.S.N.M. Acc. no. 35005, Ariz., Collection G.D. Hulst." Type locality: Arizona [USA] </p>
            <p>Description.</p>
            <p> Adult male (Fig. 8): Head: scaling dark gray to gray-brown to tan; alternating uneven banding of white to light brown scales, and dark-brown scales, labial palpus concolorous with head and body, antenna scaling: each segment alternating light gray and dark brown. Thorax: dorsum dark gray to gray brown to tan; venter lighter grayish brown. Legs: dorsally concolorous with thorax, ventrally light gray with darker scales, tarsi alternating white and dark brown; tarsal segments alternating  dark–brown to white scaling. Forewing: length as for genus description, basal line black; band of darker color runs vertically, adjacent to antemedial line, terminating where antemedia line points apically; area between medial and postmedial lines shaded darker, excluding reniform area; crenulations on margin of forewing with gray-white punctations. Hind wing: shaded gray brown from medial area distally; postmedial line complete, or faintly visible distally; subterminal line darker gray brown, outlined with light coloration distally. Abdomen: dorsum dark gray to gray brown to tan, laterally gray; venter gray, dusted with darker scales. Genitalia (Figs 3, 4) (24 dissections): Lateral processes at distal end of tegumen arms wavy; process at dorsal end fin shaped, very weakly sclerotized; ventral membrane on distal end weakly sclerotized; juxta with numerous short, pointed tubercles mesially, narrowed caudally; transtilla attached to costal parts of valve processes; vinculum with flared, fin-like processes directed anteriorly; sclerotized saccular process looping, connecting to costal region,  “D” shaped; base of costa thumblike, connected to transtilla; aedeagus with dorsal surface undulating apically; vesical with five diverticula. Adult Female (Figs 9-15): forewing length as in genus description. Similar to male, except antennae filiform. Genitalia (Fig. 5) (12 dissections): Postvaginal plate narrowed anteriorly, densely covered in shark-tooth-like tubercles, caudal 7/8th outlined in stout setae; sterigma with sclerotized ridges laterally. </p>
            <p>Variation.</p>
            <p> Specimens tend to be larger in the eastern part of the range in Texas, and smaller specimens are more common in Arizona and California. Forewing coloration ranges from dark gray with some brown dusting to tan. Maculation ranges from  well -defined antemedial, postmedial, and subcostal lines to lightly marked specimens with only the subcostal line well defined. Lightly marked specimens are found most commonly in the Mojave Desert. Ground color of hind wings is lighter towards the western range of the species. Specimens from the eastern part of the range show distinctly marked discal spots and shading on the margins on ventral surface of the wings, and the undersides are more heavily dusted with darker scales. The size of the white  patch in the reniform area varies from a narrow dash to a large spot, while forewing ground color ranged from dark gray to gray brown among moths reared from the same female collected in Southeast Arizona. </p>
            <p> Barcode variation in  Heteranassa is very conservative. Examination of more than 160 full-sequence (658 base-pair) barcodes from California, Arizona, New Mexico, Texas, and northern Mexico showed a maximum divergence of less than 0.8%. One haplotype* dominated the sample, representing more than half of the specimens; the other barcodes included 36 haplotypes that had no more than two base-pair differences from each other. One haplotype, restricted to central and southern Texas, departed from this pattern in being 0.8% different from those from farther west. This is most probably the haplotype that should be associated with the name  Heteranassa mima , it being described from this part of Texas. However, this  “eastern” haplotype is found with  “western” haplotypes in central Texas and there is no indication in genital structural characters, or wing color or pattern, that  Heteranassa includes more than a single species. The barcodes of  Heteranassa are so divergent that they give no indication of a close relationship to any other erebid genus, other than belonging in the subfamily  Erebinae , tribe  Omopterini .  Heteranassa specimens from Texas and Mexico are frequently confused with some species associated with the genus  Coxina Guenée , which can have a similar superficial pattern, but the barcodes are more than 10% different and the two genera do not appear to be closely related. (D. Lafontaine pers. comm.). </p>
            <p>*CNCNoctuoidea13382 [Baboquivari Mts., Pima Co., Arizona, USA]</p>
            <p> AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGTTTATTAATTCGTGCTGAATTAGGAAACCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTT  TATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTCCCCTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTCTGATTATTACCCCCATCTTTAACTCTTTTAATCTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAACATTGCTCATAGAGGAAGATCAGTAGATTTAGCAATTTTCTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACTATTATCAATATACGATTAAATAGATTAATATTTGACCAAATACCTTTATTTGTTTGAGCTGTTGGTATTACTGCTTTTTTACTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATACTCTTAACAGATCGAAATTTAAATACTTCCTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTTTACCAACATCTATTT</p>
            <p>Distribution and habitat.</p>
            <p>Warm, arid habitats from California to Texas, northward to Oklahoma, and south as far as Oaxaca, Mexico (Fig. 16). A single specimen from Cartwright, Manitoba is in the LACM.</p>
            <p>Discussion.</p>
            <p> The variation in  Heteranassa wing pattern and coloration is continuous, with many specimens appearing intermediate to the phenotypes described by Smith (1899) and Harvey (1876). Genitalic morphology does not, however, correlate with wing pattern differences. These observations suggest that  Heteranassa contains a single, highly variable species,  Heteranassa mima . Studies of another erebine genus,  Catocala , have shown that pressure from avian predators may drive high levels of polymorphism in forewing pattern and coloration (Ricklefs and  O’Rourke 1975, Bond and Kamil 2002, Webster et al. 2009), and  Heteranassa may be subject to similar evolutionary processes. </p>
            <p> A series of  Heteranassa from Death Valley, California collected in February, 2005, is the most variable in forewing pattern and coloration among the thousands of specimens observed to date.  Heteranassa comprised roughly 90% of the moth specimens collected during this period, demonstrating that the genus is an abundant and likely ecologically important insect herbivore in North American desert biomes. </p>
            <p> During the course of this research, we became aware of potential taxonomic affinities with the neotropical genera  Elousa Walker (1857) and  Coxina Guenée (1852). These genera have not been studied in a systematic framework since the turn of the 20th Century. A preliminary examination of male genitalia and wing pattern show significant overlap of characteristics between the genera. These three genera lack spines on the mesothoracic tibiae, and possess symmetrical male genitalia with membranous costal regions of the valves. These processes are larger in  Heteranassa and  Elousa albicans (Walker, 1857) than they are in  Elousa schausi (Giacomelli, 1911) and the other  Coxina species we have dissected. We have examined 10 species in these genera from the Caribbean and South America. Specimens belonging to this group that we collected in the Nicaraguan highlands appear more similar to  Elousa schausi specimens from Argentina and  Coxina specimens from Mexico, south Texas, and Florida, than they do to Caribbean  Elousa or North American  Heteranassa . Future research could test the monophyly of  Coxina and  Elousa with respect to  Heteranassa , and how these genera speciated in North and South America and the Caribbean. </p>
        </div>
    </body>
</html>
	https://treatment.plazi.org/id/9666720E5CC927D8BFE7B751730B15A0	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Homziak, Nicholas;Hopkins, Heidi;Miller, Kelly B.	Homziak, Nicholas, Hopkins, Heidi, Miller, Kelly B. (2015): Revision of the genus Heteranassa Smith, 1899 (Lepidoptera, Erebidae, Omopterini). ZooKeys 527: 31-49, DOI: http://dx.doi.org/10.3897/zookeys.527.8771, URL: http://dx.doi.org/10.3897/zookeys.527.8771
