identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
19BC8AAFDFF20FDC31D92A8811AF4C62.text	19BC8AAFDFF20FDC31D92A8811AF4C62.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Catharylla Zeller 1863	<div><p>Catharylla Zeller, 1863</p><p>Catharylla Zeller 1863: 50, Bleszynski and Collins 1962: 226, Landry 1993: 1088, Munroe 1995: 35, Nuss et al. 2013.</p><p>Type species.</p><p>Crambus tenellus Zeller, 1839, by subsequent designation by Schaus 1922: 131.</p><p>Diagnosis.</p><p>Catharylla species have snow white to creamy white wings and short labial palpi. They can be separated from other Argyriini by the presence on the forewing of median and subterminal thin transverse lines, slightly curved, convex on costal 1/3. The labial palpi are also shorter in comparison to those of Vaxi . The highly variable male genitalia do not show any synapomorphy or generic diagnostic character. In females, a possible synapomorphy is the strongly reduced anterior and posterior apophyses of abdominal segments VIII and IX, but this is shared with some Crambini and a few other Crambinae (see Landry 1995).</p><p>Redescription.</p><p>Head white, chaetosemata present. Antenna brown, covered with light ochreous to brown scales. Maxillary palpus light ochreous to brown, white tipped. Labial palpus 1.0-1.95 × width of head, curved upward; white basally, light ochreous to ochreous, white tipped, with some brown or dark brown. Thorax white, with ochreous to brown scales at collar. Foreleg coxa white to whitish brown, femur dorsally brown to dark brown, tibia and tarsomeres distally ringed with dark brown. Midleg white to light ochreous with tibia-femur joint ashen brown, with pair of spurs at apex of tibia, tarsomeres II–V dorsally brown to dark brown, with white tips. Hindleg white, with 2 pairs of spurs on tibia, tarsomeres as on midleg. Male frenulum simple, frenulum hook present; female frenulum with 3 or 4 acanthae. Forewing length: 7.5-15 mm in males; 9.5-22 mm in females. Wing venation (of Catharylla chelicerata) (Fig. 9): R1 present and free, not connected to Sc; R2 free; R3 connected with R4 at 3/4; R5 stalked with R3+R4 at 1/4; M1 from upper corner of cell; cell opened between M1 and M2; M2 and M3 not stalked; CuA1 from lower corner of cell; CuA2 at distal 1/3 of cell; 1A+2A strong. Hindwing Sc+R1 connected to Rs at distal 1/3; M1 connected to Sc+R1 by short narrow vein; M3 connecting to M2 at distal 1/3, CuA1 connecting to M2 at half of length and CuA2 connecting at basal 2/5; 1A unforked; 2A unforked, strong; 3A present, unforked. Forewing (Figs 1-8) background snow white; pattern with costal margin ochreous to brown, sometimes faded; median and subterminal transverse lines thin, ochreous to brown, convex toward costa; outer margin ochreous, sometimes with dark brown spots between veins, or spots forming a continuous line; fringes white; verso light ochreous to ochreous; with marginal spots pronounced. Hindwing snow white to cream-colored; with hairs along 2A and root of M2; with small dark brown spots on outer margin, sometimes in continuous line; sometimes with postmedian transverse line; verso white with marginal spots pronounced.</p><p>Tympanal organs (Fig. 10): Transverse ridge regularly rounded. Tympanic pockets more or less extending beyond transverse ridge. Tympanic bridge present, straight, lightly sclerotized. Tympanic drum more or less ovoid.</p><p>Male genitalia (Figs 11-33): Uncus long, basally wide, straight or downcurved, bare or setose. Gnathos arms connecting at 1/4 to 1/2 from base, thin, slightly curved to hook shaped, with apex pointing upward. Tegumen arms enlarging toward uncus, connecting dorsally. Valva with cucculus long, densely setose on inner side, apically more or less rounded, slightly curved upward; costal arm present, variable in shape. Transtilla present only in Catharylla tenellus group, strongly developed. Juxta medially curved downward, narrowing toward rounded apex, slightly directed downward apically, basally triangular, sometimes with additional lobes at base or ventro-lateral projections. Vinculum of medium width; saccus short, rounded, directed anterad and slightly upward. Phallus straight or curved, usually more strongly sclerotized at apex; vesica without cornuti, with one cornutus, or with crest of cornuti.</p><p>Female genitalia (Figs 34-41): Papillae anales strongly setose, connecting dorsally and ventrally, usually slightly produced dorsally, with basal band of sclerotization. Poste rior apophyses 0.25-0.45 × length of papillae anales, straight, regularly thin. Tergite VIII narrow, with postero-dorsal line of setae. Anterior apophyses reduced, 0.01-0.1 × length of papillae anales. Sternite VIII about twice length of tergite, not connecting ventrally in tenellus species group. Sterigma present, strongly sclerotized except in tenellus species group, usually forming pockets of variable shape; reduced to sclerotized lamella antevaginalis in Catharylla bijuga . Ductus seminalis connecting posteriorly at base of ductus bursae. Ductus bursae long, at least 2 × length of corpus, wide, basally curved. Corpus bursae usually rounded, egg-shaped, often enlarging progressively from ductus bursae, usually with one signum, sometimes without; corpus and ductus bursae covered with minute spicules.</p><p>Distribution.</p><p>The genus is restricted to the Neotropical Region, from Costa Rica to Santa Catarina, Brazil, from sea level to 1300 m (Figs 43-46).</p><p>Biology.</p><p>The biology of the species remains unknown. In the Serra Bonita Reserve in march 2011, we observed Catharylla serrabonita in its environment, i.e. forested hills up to about 950 m in elevation, surrounded by cacao or coffee plantations in the lowlands. The moths were coming to light, usually very late (after 23:00).</p><p>Phylogenetic relationships and monophyly.</p><p>Presumably, given the reduced labial palpi and the forewing color and pattern, Catharylla has been placed in the Argyriini (Munroe 1995). But our phylogenetic analyses do not support tribe Argyriini with Catharylla included, and the genus seems to be most closely related to Micrelephas .</p></div>	https://treatment.plazi.org/id/19BC8AAFDFF20FDC31D92A8811AF4C62	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Leger, Theo;Landry, Bernard;Nuss, Matthias;Mally, Richard	Leger, Theo, Landry, Bernard, Nuss, Matthias, Mally, Richard (2014): Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae). ZooKeys 375: 15-73, DOI: http://dx.doi.org/10.3897/zookeys.375.6222, URL: http://dx.doi.org/10.3897/zookeys.375.6222
EF70CAC8C957F4C5822419A050DCF3EA.text	EF70CAC8C957F4C5822419A050DCF3EA.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Catharylla bijuga T. Leger & B. Landry	<div><p>Catharylla bijuga T. Leger &amp; B. Landry sp. n. Figs 1, 11, 12, 34, 45</p><p>Type material.</p><p>Holotype. ♂, with labels as follows: "Pied Saut, | Oyapok [sic] River, | French Guiana, | S. M. Klages | C. M. Acc. 6111."; "Dec[ember]. | 1917"; "HOLOTYPE | Catharylla bijuga | T. Léger &amp; B. Landry" [red label]; "Catharylla | ramona sp. n. | det. Bleszynski, 1969"; "MANUSCRIPT | NAME" [white card with red lettering and thin red rectangle submarginally]; "BL 1744 ♂". Deposited in CMNH.</p><p>Paratypes. 16 ♂, 9 ♀. BRAZIL: 1 ♂ (genitalia on slide BL 1748, used for DNA Barcoding BC MTD 01840), Amazonas, P[ar]q.[ue] Nac.[ional] do Jaú, Rio Jaú, bg. Miratucú, 1°57'S, / 61°49'W, 26-27.vii.1995, U[ltra] V[iolet] light sheet (R. W. Hutchings) (USNM). FRENCH GUIANA: 2 ♂ (1 with genitalia on slide Pyralidae Brit. Mus. slide N°15893) with same data as holotype (BMNH); 5 ♂, 1 ♀ (2 ♂ with genitalia on slides Pyralidae Brit. Mus. Slide N°15891, N°15892, ♀ with genitalia on slide BL 1735) with same locality as holotype except i.1918 (1 ♂), ii.1918 (4 ♂, 1 ♀) (S. M. Klages) (BMNH, CMNH); 1 ♂, 2 ♀, Parcelles CIRAD de Combi, plantations expérimentales pk 1.5, 5°18'N, 52°55'30 W, 4.iii.2011, piège lumineux [light trap] (B. Hermier) (♂ with Hermier n° 24340, 2 ♀ with labels Hermier n° 24341 &amp; 24345) (MHNG); 3 ♂, 2 ♀ (2 ♂ with genitalia on slides BL 1719 and Pyralidae Brit. Mus. Slide N° 7815, 2 ♀ with genitalia on slides BL 1739 and BL 1740), Saint-Jean-du-Maroni (Le Moult) (BMNH); 1 ♂, Saint-Laurent-du-Maroni (USNM); 1 ♂ (genitalia on slide BL 1694, (used for DNA barcoding BC MTD 01839) Roura, 3.6km E[ast] Roura at r[oa]d to Crique Gabrielle, 50m, 20.iv.1994, at light (J. S. Miller &amp; C. Snyder) (AMNH); 1 ♀ (genitalia on slide BL 1734), Cayenne, iii.1917 (CMNH). GUYANA: 1 ♂, New River 1938 (C.A. Hudson) (BMNH); 1 ♂, Mallali [sic] (USNM). SURINAME: 1 ♀ (genitalia on slide USNM 52888), Geldersland, Surinam River (USNM); 1 ♀ (genitalia on slide BL 1732), Sipaliwini Distr[ict], Thibiti area, Kabo Creek, partly swampy, primary forest on hilly slopes, ca. 2km from river, 29.v.1989 (J. Beerlink) (Schouten Coll.).</p><p>COI barcode sequence of paratype BC MTD 01839 (654 bp): ACATTATATTTTATCTTCGGAATTTGAGCAGGAATAGTTGGAACATCCCTAAGACTTTTAATTCGAGCAGAATTAGGTAATCCAGGTTCTCTTATTGGTGACGACCAAATTTATAATACTATTGTTACTGCTCATGCATTTATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGAGGATTCGGTAATTGATTAGTTCCATTAATATTGGGAGCACCAGATATAGCATTCCCACGAATAAATAATATAAGATTTTGATTACTCCCCCCCTCTTTAATCCTATTAATTTCTAGAAGAGTTGTAGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCCCCACTTTCATCAAATATTGCTCATAGTGGTAGATCTGTAGATTTAGCAATTTTTTCTCTACACTTAGCAGGAATTTCATCAATCTTAGGAGCTATTAATTTTATTACAACAATTCTTAATATACGAATTAATGGTTTATCTTTCGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCTTTACTTCTTCTCTTATCCTTACCCGTATTAGCTGGTGCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATCCTTTACCAACACTTA</p><p>Diagnosis.</p><p>On the forewing (Fig. 1), the seven, thin, marginal dark brown dashes with the most tornal two shaped like spots will separate this species from the others. In male genitalia (Fig. 11), the strongly sclerotized double costal arm of the valva with the ventral arm tubular is a distinctive character. In female genitalia, the best diagnostic character is the sclerotized projection latero-ventrally on sternite VIII (Fig. 34).</p><p>Description.</p><p>Male (n = 17) (Fig. 1): Antenna brown with light ochreous scales; with patch of dark brown scales at base. Maxillary palpus ringed with brown at base and half of length, white tipped. Labial palpus: 1.4-1.6 mm long; ochreous, slightly lighter basally, ringed with dark brown at 2/3, white tipped. Thorax slightly ochreous at collar. Foreleg coxa white; femur ochreous, dark brown dorsally; tibia and tarsomeres ochreous, distally ringed with brown. Midleg and hindleg light ochreous; tibia-femur joint brown on midleg; tarsomeres II–V brown to dark brown on upperside, with white ringed tips. Abdomen dull white to greyish brown. Forewing length: 9.0-10.5 mm; snow white, with yellow ochreous to brown costal margin, partially disrupted when meeting transverse lines; median line yellow ochreous; subterminal line yellow ochreous to brown, forming small triangular spot on costal margin; subapical triangle on costal margin ochreous; outer margin slightly ochreous with five dark brown dashes regularly spaced or sometimes forming faintly continuous line, and one cubital and one anal spots, with cubital spot slightly displaced toward base; fringes brass colored; underside dull white to light ochreous along costal margin, with marginal dashes pronounced. Hindwing snow white, veins slightly ochreous, with shiny aspect; marginal line thin, brown, pronounced up to CuA1, then shiny white; fringes white; underside white, with same margin as on recto.</p><p>Tympanal organs (n = 8): Tympanic pockets extending slightly beyond transverse ridge, rounded. Tympanic drum elongate, more or less oval, postero-laterally extended beyond transverse ridge.</p><p>Male genitalia (n = 8) (Figs 11, 12): Uncus slightly down-curved, about 3/5 length of tegumen arms, with few setae laterally; tip pointed; uncus arms not separated at base, forming low bump medio-ventrally. Gnathos arms joining at half their length; distal half with short, rounded, dorsal projection at base; directed upward subapically at about 50° angle; slightly shorter than uncus and thinner. Tegumen pedunculi progressively widening toward uncus; dorsal connection of tegumen about 1/3 length of pedunculi; ventral margin straight; dorsal margin slightly convex, bare. Cucculus moderately wide, narrowing in distal 1/4; costal arm of valva double, bare, about as long as cucculus, joined to cucculus until 3/5 of its length; ventral arm thin, tubular, strongly sclerotized, slightly curved inward, apex directed upward, narrowed, pointed; dorsal arm broader, slightly shorter than ventral arm, straight, apically rounded, less thickly sclerotized than ventral arm. Vinculum enlarging latero-dorsally, ventrally narrow; saccus short, rounded. Juxta triangular, apically broadly rounded, slightly curved downward, basally projected into two large lateral lobes. Phallus almost straight, with slightly upturned sclerotized apex; vesica covered with microspicules barely visible, with one large, curved, pointed cornutus.</p><p>Female (n = 10): Labial palpi: 1.1-1.4 mm long. Forewing length: 11-15 mm; frenulum triple.</p><p>Female genitalia (n = 6) (Fig. 34): Papillae anales slightly projected ventrally and dorsally, dorsally forming prominent sclerotized rounded bulge. Posterior apophyses widened basally, 0.35-0.5 × length of papillae anales. Segment VIII circular in cross section, enlarging progressively toward papillae. Tergite VIII narrow, about 2/5 length of sternite VIII, with short setae along posterior edge. Anterior apophyses wide at base, about 0.1 × length of papillae. Sterigma with thin slightly sclerotized membrane covered with minute spicules dorsad of ostium bursae, with posterior margin slightly indented; with sclerotized projection laterad from sternite VIII antero-ventrally, with tip bifid, longer part directed downward, shorter part lateral, curved posterad. Basal part of ductus bursae ventrally sclerotized, looping and narrow, progressively widening toward corpus bursae. Corpus bursae poorly differenciated from ductus, twice as long as wide, without signum.</p><p>Distribution.</p><p>The species occurs in lowlands in the three Guianas and Brazil (Fig. 45).</p><p>Etymology.</p><p>Bijuga comes from the Latin bijugus, a, um which means "yoked together, double", in reference to the bifid costal arm of the male genitalia.</p><p>Notes.</p><p>In some paratypes from French Guiana the collecting data mention a “pk” (="point kilométrique”). This kilometric marker refers to the distance of the collecting spot on the forest road to the nearest main road. CIRAD (Centre de coopération internationale en recherche agronomique pour le développement) refers to the name of the research institution leading agronomical research on the Combi site. the Combi site. When S. Bleszynski looked into Catharylla, he gave the manuscript name Catharylla ramona to this species, but never published it. The comparison of the tip of the tubular costal arm of the male genitalia and the female lateral projections of sternite VIII shows rather nicely that the male hooks the female genitalia during the mating process. The specimen collected in Parque Nacional do Jaú, Brazil, shows a divergence in COI barcode sequence of 5.05% with that of Roura, French Guiana. In morphology we find no significant difference corroborating this divergence. The relationships of this species to the others remain uncertain in our phylogenetic analyses.</p></div>	https://treatment.plazi.org/id/EF70CAC8C957F4C5822419A050DCF3EA	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Leger, Theo;Landry, Bernard;Nuss, Matthias;Mally, Richard	Leger, Theo, Landry, Bernard, Nuss, Matthias, Mally, Richard (2014): Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae). ZooKeys 375: 15-73, DOI: http://dx.doi.org/10.3897/zookeys.375.6222, URL: http://dx.doi.org/10.3897/zookeys.375.6222
4DFD6E9EE74A8777069BDF702ED4C9AC.text	4DFD6E9EE74A8777069BDF702ED4C9AC.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Catharylla chelicerata T. Leger & B. Landry	<div><p>Catharylla chelicerata T. Leger &amp; B. Landry sp. n. Figs 2, 9, 13, 14, 35, 43</p><p>Type material.</p><p>Holotype. ♂, with labels as follows: "/600/ Parcelles CIRAD de Combi, | plantations expérimentales pk 1,8 | 5°18'N, 52°55'30"W | 3.XII.2010 | B[ernard]. Hermier | [ piège lumineux]"; 1 ♂, "Hermier | n° 23939"; "MHNG | ENTO ♂ | 00007213"; "Don de Bernard | Hermier | MHNG 2013"; "HOLOTYPE | Catharylla | chelicerata | T. Léger &amp; B. Landry" [red label]. Deposited in MHNG.</p><p>Paratypes. 20 ♂, 4 ♀. BRAZIL: 1 ♂ (genitalia on slide BL 1714), Amazonas, Rio Negro, Mirapinima, 8.iv.1972 (E. G., I. &amp; E. A. Munroe) (CNC); 9 ♂, 1 ♀, Reserva Ducke, km 26 Manaus–Itacoatiara Highway, 15.iv.1972 (1 ♂), 18.iv.1972 (1 ♂, with genitalia on slide BL 1721), 21.iv.1972 (2 ♂, one with genitalia on slide BL 1709), 16.v.1972 (2 ♂), 17.v.1972 (2 ♂, one with genitalia on slide BL 1738), 18.v.1972 (1 ♂, 1 ♀ with genitalia on slide BL 1711) (E.G., I. and E.A. Munroe) (CNC). FRENCH GUIANA: 5 ♂, 1 ♀, 36km SE, Roura (Camp Patawa), 21.xi.2007 (1 ♂, genitalia on slide MHNG ENTO 6239), 29-30.xi.2007 (3 ♂, 1 ♀, one ♂ with wings on slide MHNG ENTO 6272, 2 ♂ used for DNA sequencing and barcoding, one with labels LEP 963, BC MTD 01703, genitalia on slide TL 1, one with labels LEP 964, BC MTD 01704, genitalia on slide TL 2, ♀ with genitalia on slide MHNG ENTO 6240), 30.xi.2007 (1 ♂) (MHNG); 1 ♀ (abdomen used for DNA sequencing LEP 1290, genitalia on slide BL 1750) with same data as holotype; 1 ♂, same data as holotype except 2.ix.2011 (Hermier n° 24755); 1 ♀, same data as holotype except /604/ and 4.iii.2011 (Hermier n° 24344); 2 ♂, Beauséjour, N[ationale] 1 pk 28.5, 4°42'30"N, 52°23'30"W, 3.vi.2011, piège lumineux (Hermier n° 24545 &amp; 24546) (B. Hermier) (MHNG); 1 ♂, Route d’Apatou pk 25.5 spk 2+4.4, 1.x.2011, piège lumineux (B. Hermier) (Hermier n° 24956) (MHNG); 1 ♂ (genitalia on slide BL 1749), R[ou]te forestière de Saut Léodate pk 4.5, 4°55'N, 52°33'W, 31.x.1995 piège lumineux (B. Hermier) (Hermier n° 8457) (MHNG).</p><p>Other specimens. 1 ♀ (genitalia on slide GS-5949-SB), Nova Olinda, Rio Purus, v.1922 (S. M. Klages) (CMNH); 1 ♀ (genitalia on slide Pyralidae Brit. Mus. Slide N° 17693), Teffé [sic], vi.1906 (W. Hoffmanns) (BMNH).</p><p>COI barcode sequence of paratype BC MTD 01703 (654 bp): ACTTTATATTTTATCTTTGGAATTTGAGCAGGAATAATTGGAACATCCTTAAGACTACTAATTCGAGCAGAATTAGGTAATCCTGGATCTCTTATCGGGGATGACCAAATTTATAACACTATTGTTACTGCTCATGCATTTGTAATAATCTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAACTGATTAGTACCTTTAATGCTAGGGGCACCAGATATAGCATTCCCTCGTATAAATAATATAAGATTTTGACTTCTTCCCCCCTCTTTAACCCTATTAATTTCAAGTAGAATTGTAGAAAATGGGGCAGGAACAGGATGAACCGTTTATCCACCTTTATCATCTAATATTGCCCATGGAGGCAGATCAGTAGATCTGGCAATTTTTTCACTACATTTAGCTGGAATTTCATCAATTTTAGGGGCAATTAATTTTATTACAACAATTATTAATATACGAATTAATAATCTTTCATTTGATCAAATACCCCTATTTGTTTGATCAGTAGGTATTACAGCATTACTATTACTTCTATCTTTACCAGTATTGGCGGGAGCTATTACCATACTTCTAACTGACCGAAATCTCAATACTTCCTTTTTTGATCCAGCAGGGGGGGGAGACCCTATTTTATATCAACACCTA</p><p>Diagnosis.</p><p>From Catharylla gigantea, Catharylla chelicerata differs in having the male costal arm hook shaped, longer, and thinner than in Catharylla gigantea, and the juxta is strongly downcurved, apically conical whereas it is long, almost straight, without apical conical projection downward in Catharylla gigantea . In female genitalia the sterigma forms a strongly sclerotized symmetrical structure made of two asymmetrical bell-shaped cavities, opened anterad in Catharylla chelicerata whereas it forms a pair of shallow pockets opened posterad in Catharylla gigantea .</p><p>Description.</p><p>Male (n = 21) (Figs 2, 9): Head with ochreous to brown chaetosemata. Antenna greyish brown with light brown scales, with patch of brown scales at base. Maxillary palpus ochreous to dark brown, lightly ringed with dark brown at 2/3, white tipped. Labial palpus: 1.3-2.0 mm long; ochreous, basally white, tip of segment II light greyish-brown; white tipped. Thorax with dark brown patch at collar. Foreleg coxa white; femur white, ashen brown dorsally, tibia and tarsomeres ochreous, distally ringed with dark brown. Midleg femur white, tibia ashen brown basally, tarsomeres ochreous, brown to ashen brown on upperside, with white ringed tips. Hindleg white, tarsomere I ochreous; II–V brown on upperside, with white ringed tips. Abdomen dull white to light ochreous. Forewing length: 10.5-15.0 mm; costal band wide, brown from base to apex; median and subterminal transverse lines faded brown, sometimes completely faded; dark brown spots on apical margin forming more or less continuous line; fringes brass colored; underside white with costal margin brown; outer margin with somewhat triangular spots. Hindwing snow white, with marginal spots between veins; fringes white; underside silvery white with marginal spots pronounced.</p><p>Tympanal organs (n = 9): Transverse ridge almost straight medially. Tympanic pockets conical, extending slightly beyond transverse ridge. Tympanic bridge lightly sclerotized, dorsal base of praecinctorium sclerotized. Tympanic drums elongate, bean shaped, posteriorly reaching transverse ridge or slightly beyond.</p><p>Male genitalia (n = 9) (Figs 13, 14): Uncus straight, of about 4/5 length of tegumen arms, dorso-ventrally compressed, with setae dorsally and laterally; apex truncated, slightly rounded, tip with short projection pointing posterad, ventrally convex, sometimes with median bump. Gnathos arms joining at 1/5 of length, regularly hook shaped, forming angle of about 100° with axis of basal arms, about 1/4 longer than uncus. Tegumen arms narrow at base, enlarging progressively toward dorsum to 2 × basal width, projected dorsally with bump at connection, connecting at distal 1/6. Cucculus densely setose, slightly directed upward on distal 1/3, apically truncated; basal 2/3 of costa of valva dorso-ventrally and laterally widened; costal arm hook-shaped, strongly sclerotized, directed upward at about 45° from costal arm base. Juxta triangular, curved downward, tip rounded and sac-like, basal lateral lobes curved ventrally. Saccus short, curved upward medially. Phallus narrow, S-shaped; vesica covered with tiny spicules, with one large, curved, pointed cornutus apically, preceded by string of 13-14 smaller cornuti increasing in size toward apex.</p><p>Female (n = 4): Labial palpi: 1.8-2.2 mm long. Forewing: 15-19.5 mm. Frenulum quadruple.</p><p>Female genitalia (n = 3) (Fig. 35): Papillae anales dorsally strongly produced posterad, with rounded bulge dorso-apically; ventrally slightly produced. Posterior apophyses 0.3-0.45 × length of papillae. Tergite VIII about half of length of sternite VIII. Anterior apophyses about 0.1 × length of papillae anales, slightly wider and rounded apically. Sternite VIII narrowing ventrally, densely covered with spinules, slightly connected medially at lamella antevaginalis; lamella antevaginalis slightly projected downward. Sterigma forming strongly sclerotized ventro-laterally symmetrical structure made of two asymmetrical bell-shaped cavities in ventral view, opened anterad, with dorsal lobe longer, expanding upward, slightly indented along latero- anterior margin; covered with minute punctuation. Ventro-basal section of ductus bursae tongue shaped, strongly sclerotized; ductus bursae long, ventrally sclerotized, widened and looped in basal half; enlarging progressively into corpus bursae. Corpus bursae egg-shaped with one signum.</p><p>Distribution.</p><p>The species was found in French Guiana and Brazil (Amazonas) (Fig. 43).</p><p>Etymology.</p><p>" Chelicerata " refers to the shape of the costal arms of the male valva, which look like mygalomorph chelicerae.</p><p>Notes.</p><p>Two females included here have been named Catharylla robustella (genitalia on slide GS-5949-SB, CMNH) and Catharylla tenellina (genitalia on slide Pyralidae Brit. Mus. Slide N°17693, BMNH) by S. Bleszynski, as indicated on labels, but these names were never published. These two specimens are probably Catharylla chelicerata, but the bad genitalia preparations do not allow to see details, and therefore they are not included as paratypes.</p></div>	https://treatment.plazi.org/id/4DFD6E9EE74A8777069BDF702ED4C9AC	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Leger, Theo;Landry, Bernard;Nuss, Matthias;Mally, Richard	Leger, Theo, Landry, Bernard, Nuss, Matthias, Mally, Richard (2014): Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae). ZooKeys 375: 15-73, DOI: http://dx.doi.org/10.3897/zookeys.375.6222, URL: http://dx.doi.org/10.3897/zookeys.375.6222
AFBC37122FE0A716CDB27F98E3B8A7AA.text	AFBC37122FE0A716CDB27F98E3B8A7AA.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Catharylla gigantea T. Leger & B. Landry	<div><p>Catharylla gigantea T. Leger &amp; B. Landry sp. n. Figs 3, 15, 16, 36, 43</p><p>Type material.</p><p>Holotype. ♂, with labels as follows: "Brazil: Amazonas, Manaus, | Reserva Ducke, AM-010, k[ilo]m[eter]. 26 | 2°55'S, 59°59'W, Dec[ember].13, 1993 | J. Bolling Sullivan &amp; | Roger W. Hutchings | U[ltra]V[iolet] Light (Plateau Hut)"; "HOLOTYPE | Catharylla gigantea | T. Léger &amp; B. Landry" [red label]; "BL 1747 ♂" [light green label]. Deposited in USNM.</p><p>Paratypes. 5♂, 2 ♀. BRAZIL: 1 ♂, Amazonas, Reserva Ducke, km. 26, Manaus–Itacoatiara Highway, 15.v.1972 (E. G., I. and E. A. Munroe) (CNC). FRENCH GUIANA: 1 ♂, 1 ♀ (genitalia respectively on Pyralidae Brit. Mus. slides N° 11224 and 11342), Saint-Jean-du-Maroni (E. Le Moult) (BMNH); 1 ♂ (genitalia on slide GS-6694-SB), Oyapok [sic] River, Pied Saut, iii.1918 (S. M. Klages) (CMNH). GUYANA: 2 ♂, 1 ♀ (1 ♂ with genitalia on slide BL 1716, ♀ with genitalia on Pyralidae Brit. Mus. Slide N° 19017), Potaro, ii.1908 (2 ♂), v.1908 (1 ♀) (S. M. Klages) (BMNH).</p><p>Diagnosis.</p><p>From Catharylla chelicerata, Catharylla gigantea differs in having the male costal arm shorter, basally wide and tooth shaped while it is long, narrow throughout and hook shaped in Catharylla chelicerata . The juxta is long, tongue shaped, almost straight, and apically rounded, whereas it is downcurved and apically conical in Catharylla chelicerata . In female genitalia, the sterigma forms a pair of shallow pockets opened posterad whereas in Catharylla chelicerata the sterigma forms a strongly sclerotized symmetrical structure made of two asymmetrical bell-shaped cavities opened anterad.</p><p>Description.</p><p>Male (n = 6) (Fig. 3): Head with ochreous chaetosemata. Antenna brown with light brown scales, with patch of dark brown scales at base. Maxillary palpus brown with dark brown spot at half of length, white tipped. Labial palpus: 1.6-2.4 mm long; ochreous to brown ochreous, basally white, with patch of dark brown scales at half of length, white tipped. Thorax with some brown at collar. Foreleg coxa white, femur white, ashen brown dorsally; tibia and tarsomeres brown-ochreous, distally ringed with dark brown. Midleg white with tibia-femur joint and base of tibia ashen; tarsomeres ochreous to brown ochreous with upperside brown to dark brown, white tipped. Hindleg white with tarsomeres II–V ochreous to brown ochreous, upperside brown, with white tips. Forewing length: 13.5-14.5 mm; snow white with wide brown to dark brown costal line from base to apex; median and subterminal transverse lines faded brown; dark brown spots on termen forming more or less continuous line; fringes brass colored; underside white, with costal margin brown ochreous, outer margin with subtriangular spots. Hindwing snow white; marginal spots dark brown between R5, M1, M2, M3, and CuA1; fringe white; underside snow white, with same spots as on upperside.</p><p>Tympanal organs (n = 5): Transverse ridge medially convex. Tympanic pockets extending slightly beyond transverse ridge, rounded. Tympanic bridge lightly sclerotized, dorsal base of praecinctorium sclerotized. Tympanic drums elongate, bean shaped.</p><p>Male genitalia (n = 5) (Figs 15, 16): Uncus straight, about 3/4 length of tegumen arms, dorso-ventrally flattened, dorsally convex, ventral margin convex in basal half, concave in distal half; basally and laterally setose; apex slightly rounded, medially with short projection pointing postero-ventrally. Gnathos arms joining at 1/5, about 1/4 longer than uncus, regularly curved. Tegumen arms narrow at base, widening regularly to reach 1.5 × basal width dorsally, with connection at distal 1/6. Cucculus densely setose, broad at base, slightly widening and truncate at apex; costal arm of valva basally wide, short, tooth shaped, slightly curved inward. Juxta long, tongue shaped, almost straight, apically rounded, with basal lateral lobes curved ventrally. Saccus short, curved upward. Phallus narrow, S-shaped; vesica covered with tiny spicules, with string of 14 small cornuti increasing in size toward apex, with apical cornutus up to 5 × length of previous one.</p><p>Female (n = 2): Labial palpi: 2.5-3.1 mm long. Forewing length: 17.5-22 mm; frenulum triple.</p><p>Female genitalia (n = 2) (Fig. 36): Papillae anales ventrally projected. Posterior apophyses about 0.35 × length of papillae anales, narrow. Segment VIII narrowing ventrally, densely covered with spinules; narrow connection at lamella antevaginalis; lamella antevaginalis slightly projected downward. Sterigma forming pair of shallow pockets opened posterad at base of segment VIII. Anterior apophyses about 0.08 × length of papillae anales, of medium width, basally wide. Ductus bursae wide, as long as twice segment VIII, regularly enlarging into corpus bursae. Corpus bursae with one rounded signum.</p><p>Distribution.</p><p>Catharylla gigantea has been found in French Guiana, Guyana, and Brazil (Amazonas) (Fig. 43).</p><p>Etymology.</p><p>The name comes from the Latin giganteus, a, um meaning very large.</p><p>Notes.</p><p>The name was given to the species on manuscript labels by S. Blezynski, probably in reference to the large size of the female.</p></div>	https://treatment.plazi.org/id/AFBC37122FE0A716CDB27F98E3B8A7AA	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Leger, Theo;Landry, Bernard;Nuss, Matthias;Mally, Richard	Leger, Theo, Landry, Bernard, Nuss, Matthias, Mally, Richard (2014): Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae). ZooKeys 375: 15-73, DOI: http://dx.doi.org/10.3897/zookeys.375.6222, URL: http://dx.doi.org/10.3897/zookeys.375.6222
18ED9374AA903199FE961C3AF9ADED84.text	18ED9374AA903199FE961C3AF9ADED84.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Catharylla tenellus (Zeller 1839) Zeller 1839	<div><p>Catharylla tenellus (Zeller, 1839) Figs 4, 17, 18, 27-29, 37, 45</p><p>Crambus tenellus Zeller, 1839: 174-175</p><p>Catharylla tenella: Zeller 1863: 50; Bleszynski and Collins 1962: 226; Landry 1993: 1088; Munroe 1995: 35; Nuss et al. 2013.</p><p>Argyria tenella: Zeller 1877: 58; Dyar 1914: 317</p><p>Platytes tenella: Hampson 1896: 944</p><p>Type material.</p><p>Holotype. ♀, “Type” [red ringed]; "Catharylla | tenella Z[eller]. | Mon[ograph]. p[age]. 50 Am. anftr." [not clearly readable]; "Zell[er]. Coll[ection]. | 1884"; "♀ | Pyralidae | Brit[ish]. Mus[eum]. | Slide N° | 1094". Deposited in BMNH.</p><p>Other specimens examined. 20 ♂, 7 ♀. BRAZIL: 3 ♂ (1 ♂ with leg used for DNA barcoding BC MTD 01842, 1 ♂ with genitalia on slide BL 1757), São Paulo, Ubatuba, Picinguaba, 23°22'S, 44°50'W, 2-20m, 22-24.ix.2001 (V. O. Becker n°132820) (Becker Coll.); 2 ♂ with same data except 10-12.xi.2001 (V. O. Becker n°133712) (Becker Coll.); 2 ♂, 1 ♀ (1 ♂ with genitalia on slide BL 1741, ♀ genitalia on slide BL 1742), São Paulo, Bertioga, 5 m, 5.xi.1995 (V. O. Becker n°99090) (USNM); 1 ♂ (genitalia on slide BL 1778) with same data (Becker Coll.); 1 ♂ (genitalia on slide BL 1775) with same data except 15-17.v.1996 (V. O. Becker n° 99386) (Becker Coll.); 1 ♂ with same data except 7-9.x.1996 (V. O. Becker Coll. n°99757) (Becker Coll.); 1 ♂ (used for DNA sequencing and barcoding LEP 975, BC MTD 01711, genitalia on slide TL 13), São Paulo, São Luiz do Paraitinga, 23°20'S, 45°06'W, 900 m, 13-20.iii.2001 (V. O. Becker n°132356) (Becker Coll.); 1 ♂ (genitalia on slide Pyralidae Brit. Mus. Slide N° 19065), São Paulo, 700 m (E. D. Jones) (BMNH); 1 ♂ (genitalia on slide BL 1746), Minas Gerais, Caraça, 1300 m, 1-2.iv.1992 (V. O. Becker n°85081) (USNM); 1 ♀ (genitalia on slide BL 1754) with same data (Becker Coll.); 1 ♂ (genitalia on slide BL 1755) with same data except 25.x.1994 (V. O. Becker &amp; K. S. Sattler, n°93291) (Becker Coll.); 1 ♂, 1 ♀ (♂ used for DNA sequencing and barcoding LEP 973, BC MTD 01709, genitalia on slide TL 11, ♀ genitalia on slide BL 1758), Bahia, Porto Seguro, A. d’Ajuda, 16°27'S, 39°03'W, 20 m, 12.vii.2009 (V. O. Becker n°144140) (Becker Coll.); 2 ♂ (used for DNA sequencing and barcoding, one with labels LEP 972, BC MTD 01888, genitalia on slide TL 10, other with labels LEP 974, BC MTD 01710, genitalia on slide TL 12) with same data except 15.viii.2008 (V. O. Becker n°140808) (Becker Coll.); 1 ♂ (used for DNA sequencing and barcoding LEP 971, BC MTD 01708, genitalia on slide TL 9) with same data except 1-3.v.2009 (V. O. Becker n°142784) (Becker Coll.); 1 ♂, Paranà, Castro (USNM); 1 ♀ (genitalia on slide BL 1733), Rio de Janeiro, xi[day and year data missing] (H. H. Smith) (CMNH); 1 ♀ (genitalia on Pyralidae Brit. Mus. Slide N°19069), Rio de Janeiro, Corcovado, 457 m, 26.xii.1958 (E. P. Wiltshire) (BMNH). No locality data: 1 ♂, 1 ♀ (♂ genitalia on slide Nat[ur]. hist[orisches]. Mus[eum]. Wien Gen[italia]. Praep[aration]. MV 9022a, ♀ genitalia on slide Nat. hist. Mus. Wien Gen. Praep. MV 9022b); 1 ♀ (genitalia on slide Nat. hist. Mus. Wien Gen. Praep. MV 9022c), 1869 (NMW).</p><p>COI barcode sequence of specimen BC MTD 1710 (654 bp): ACTCTATATTTTATCTTTGGAATTTGATCAGGAATAATTGGAACATCTTTAAGATTATTAATTCGAGCAGAATTAGGGAATCCTGGATCTCTAATTGGAGATGATCAAATTTATAACACTATTGTAACAGCCCATGCATTTATTATAATTTTTTTTATGGTTATACCAATTATAATTGGTGGATTTGGAAATTGATTGGTTCCATTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAACATAAGATTTTGGTTATTACCCCCTTCCTTAACTCTTTTAATTTCTAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACGGTCTACCCCCCCCTTTCATCTAATATTGCCCATAGTGGAAGATCTGTAGATTTAGCAATCTTTTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGTAATTTATCTTTTGATCAAATACCTTTATTTGTTTGATCAGTCGGTATTACAGCTTTACTTCTTCTTCTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATCTTATATCAACATTTA</p><p>Diagnosis.</p><p>From Catharylla serrabonita and Catharylla coronata, Catharylla tenellus can be separated by the median transverse line, which is faintly convex towards costa, whereas it is more strongly convex in Catharylla coronata and Catharylla serrabonita . The male genitalia provide the best diagnostic characters. The most obvious refers to the transtilla, which forms a pair of short, narrow sclerotized arms with pointed tips, projecting posterad, with, in between, a pair of brushes directed medio-ventrally, whereas it forms a pair of arms pointing posterad with a string of spines ventrally in Catharylla serrabonita and Catharylla coronata . In female genitalia, the anterior angle of sternite VIII is directed downward into a more or less rounded projection covered with short spinules of same length, whereas it is projected anterad in Catharylla serrabonita, and it is not projected in Catharylla coronata .</p><p>Redescription.</p><p>Male (n = 20) (Fig. 4): Head white with ochreous chaetosemata. Antenna brown with ochreous scales. Maxillary palpi ochreous to brown, white tipped. Labial palpi: 1.1-1.4 mm long; basally white, medially brown ochreous with white tips . Thorax slightly ochreous at collar. Foreleg coxa white; femur ochreous, dorsally dark brown; tibia and tarsomeres ochreous, distally ringed with dark brown. Midleg light ochreous with tibia-femur joint brown; tarsomeres II–V dark brown on upperside, with white ringed tips. Hindleg white; tarsomeres as midleg. Forewing length: 10.5-12 mm; snow white; costal line ochreous, lightly pronounced from base to apex; median and subterminal transverse lines ochreous, median transverse line faintly convex towards costa; outer margin ochreous with 7 dark brown spots often triangular, strongly pronounced; fringes brass colored; underside ochreous with costal margin pronounced in basal half and marginal spots pronounced. Hindwing cream-coloured; outer margin with small ochreous brown spots forming more or less continuous line between Sc+R1, Rs, M1, M2, M3, CuA1 and CuA2; underside light ochreous, with marginal spots pronounced; fringes white.</p><p>Tympanal organs (n = 13): Transverse ridge more or less regularly rounded, medially more straight. Tympanic pocket extending slightly beyond transverse ridge. Tympanic drum ovoid, posteriorly not extended beyond transverse ridge. Tympanic bridge faintly sclerotized.</p><p>Male genitalia (n = 13) (Figs 17, 18, 27-29): Uncus about half of length of tegumen arms, broadly downcurved; uncus arms connecting at base, with ventro-lateral tuft of setae; dorsal furrow with few short setae on each side, tip rounded, slightly indented medially, slightly convex in apical 1/3. Gnathos short and thick, arms joining at half of length, laterally compressed toward apex, almost straight, slightly downcurved, with apex pointing upward. Tegumen arms slightly enlarging toward apex; connecting at 3/4, slightly projected dorsally at connection. Costa of valva at 2/3 with arm directed postero-dorsally with rounded tip, without basal projection on dorsal edge or narrow with low basal projection, or wide with basal projection; cucculus upcurved in apical 1/4. Juxta ogival, posteriorly directed downward, with pair of thumb-like lobes ventrally reaching about 2/3 of length. Transtilla strongly sclerotized, with pair of narrow arms on each side of middle, pointing posterad, with 3 spines apically, also with pair of shorter brushes of tightly set spines medio-ventrally; in some specimens triangular median projection dorsally with few tiny setae. Phallus S-shaped, subapically with dorsal bump, apically lightly sclerotized, truncated, covered with microspicules barely visible; vesica without cornuti.</p><p>Female (n = 7): Labial palpi: 1.6-2 mm; forewing length 12-16 mm; frenulum triple.</p><p>Female genitalia (n = 7) (Fig. 37): Papillae anales straight, thick. Posterior apophyses narrow 0.3-0.45 × length of papillae anales, slightly wider basally. Intersegmental membrane between segments VIII and IX covered with microspines. Tergite VIII laterally about 2X longer than dorsally; sternite VIII formed by 2 lobes regularly narrowing downward in more or less triangular shape, not connected ventrally, densely covered with short spinules of same length; ventro-anterior angle of sternite VIII slightly projected downward, rounded, covered with short spinules; anterior margin of segment VIII latero-dorsally strongly sclerotized, thicker; posterior margin with dorsal line of setae. Anterior apophyses 0.02-0.05 × length of papillae anales. Sterigma membranous, covered with spinules. Ductus bursae about 3 × length of corpus bursae, narrow. Corpus bursae elongate, sometimes with one signum.</p><p>Distribution .</p><p>The species is known from Brazil in the Atlantic Forest (Bahia, Minas Gerais, Paraná, Rio de Janeiro, Saõ Paulo) (Fig. 45).</p><p>Notes. The species was described from "one female collected in Brazil, near Rio de Janeiro". Hence, the lectotype designated by a label by S. Bleszynski is not warranted. This designation is presumably based on the fact that Zeller (1863: 50) mentions a pair deposited in the Vienna Museum. The association of sexes in this species is not 100% certain.</p><p>Specimens from Porto Seguro, Brazil show a divergence of 3.34% in COI barcode sequences with the specimen from Ubatuba, Brazil. In morphology, differences in male genitalia are also observed: in the specimens from Bertioga, Caraça, São Paulo and Ubatuba the costal arm of the valva is wide and 1/3 of the length of the cucullus, almost reaching its tip, and the dorsal edge at base is slightly produced (Fig. 27). In the specimens from Porto Seguro, the costal arm is about 1/5 the length of the cucullus, relatively narrow, and the dorsal edge is slightly produced at base (Fig. 29). Another form, from Caraça, Minas Gerais (Fig. 28) was also found. No differences were found in the female genitalia. We feel that specimens and data are currently lacking to conclude that possibly more than one taxon should be recognized under Catharylla tenellus, or that there is indeed a deep divergence in the COI barcode between populations of this species.</p></div>	https://treatment.plazi.org/id/18ED9374AA903199FE961C3AF9ADED84	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Leger, Theo;Landry, Bernard;Nuss, Matthias;Mally, Richard	Leger, Theo, Landry, Bernard, Nuss, Matthias, Mally, Richard (2014): Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae). ZooKeys 375: 15-73, DOI: http://dx.doi.org/10.3897/zookeys.375.6222, URL: http://dx.doi.org/10.3897/zookeys.375.6222
C575A3423350B2EB56556E02A23B7179.text	C575A3423350B2EB56556E02A23B7179.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Catharylla coronata T. Leger & B. Landry	<div><p>Catharylla coronata T. Leger &amp; B. Landry sp. n. Figs 5, 19, 20, 38, 45</p><p>Type material.</p><p>Holotype. ♂, with labels as follows: "Col. BECKER | 81552"; "BRASIL:ES | Linhares, 40m | 20-29.ii.1992 | V.O.Becker Col"; "HOLOTYPE | Catharylla | coronata | Léger &amp; Landry" [red label]. Deposited in Becker Collection.</p><p>Paratypes. 21 ♂, 4 ♀. BRAZIL: 5 ♂ with same data as holotype (1 used for DNA barcoding BC MTD 01890, 1 with genitalia on slide BL 1743); 2 ♂ with same data as holotype (1 used for DNA barcoding BC MTD 01891) except 05-09.iv.1992 (V. O. Becker n°82486); 6 ♂, 1 ♀ (1 ♂ with genitalia on slide BL 1730, ♀ with genitalia on slide BL 1731), Paranà, Rio Negro, 900 m, 8.ii.1973 (2 ♂), 10.ii.1973 (1 ♂), 11.ii.1973 (3 ♂), 13.ii.1973 (1 ♀) (A. &amp; J. Razowski) (ISZP); 2 ♂, 2 ♀, Paranà, Curitiba, 920 m, 17.ii.1975 (1 ♂) (V. O. Becker n°10167), 20.ii.1975 (1 ♀, genitalia on slide BL 1756) (V. O. Becker n°10168), 12.iii.1975 (1 ♀, genitalia on slide BL 1753) (V. O. Becker n°10166), 10.x.1975 (1 ♂) (V. O. Becker n°4010) (Becker Coll.); 1 ♂ (genitalia on Pyralidae Brit. Mus. Slide No. 11357), Paranà, Castro, 950 m (E. D. Jones) (BMNH); 1 ♂, Paranà, Quatro Barras, 850 m, 27.ii.1970 (Laroca &amp; Becker) (V. O. Becker n°15442) (Becker Coll.); 1 ♂ (genitalia on Pyralidae Brit. Mus. Slide No. 11337) Rio de Janeiro, Novo Friburgo (BMNH); 1 ♂ (genitalia on Pyralidae Brit. Mus. Slide. No. 19019) Sao Paulo, 700 m (E. D. Jones) (BMNH); 1 ♂, 1 ♀ (♂ with genitalia on slide BL 1774, ♀ with genitalia on slide BL 1736), Santa Catarina, Rio Vermelho, 968 m, 18.ii.1973 (♂), 28. ii. 1973 (♀) (A. &amp; J. Razowski) (ISZP); 1 ♂, no locality data (V. O. Becker) (Becker Coll.).</p><p>COI barcode sequence of paratype BC MTD 01890 (654 bp): ACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGATCTCTTATTGGAGATGATCAAATCTATAATACTATTGTAACCGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTTCCCTTAATATTAGGAGCACCAGATATAGCTTTTCCTCGAATAAATAACATAAGATTTTGATTATTACCCCCCTCTTTAACTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATAGTGGAAGATCCGTAGATTTAGCAATCTTTTCCCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATCAATAATCTTTCATTTGATCAAATACCTCTTTTTGTTTGATCAGTAGGAATTACAGCTTTACTTCTTCTTTTATCATTACCAGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCCGCAGGAGGAGGAGATCCTATTTTATATCAACATTTA</p><p>Diagnosis.</p><p>From Catharylla serrabonita and Catharylla tenellus, Catharylla coronata can be separated with characters of the male genitalia: the uncus is apically bifid and grooved on distal 1/5 in Catharylla coronata whereas it is only indented medially at apex in Catharylla serrabonita and Catharylla tenellus; the costal arm of the valva is short and the apex is curved inward in Catharylla coronata whereas the costal arm is longer and points postero-dorsally in the other two species; the transtilla forms a pair of sclerotized arms slightly bent inward distally, ventrally with a row of short spines increasing in size from base to apex whereas it forms a pair of short, narrow sclerotized arms with pointed tips, projecting posterad, and with a pair of brushes directed medio-ventrally in Catharylla tenellus and a pair of sclerotized arms strongly bent inward on distal 1/4 and with a string of long spines of same length medially along it in Catharylla serrabonita; the juxta is shorter than in Catharylla tenellus, and regularly narrowing toward apex whereas it is strongly narrowing on distal 1/4 in Catharylla serrabonita; the ventral projections of the juxta form a pair of shallow pockets whereas they are bell-shaped in Catharylla serrabonita and thumb-like in Catharylla tenellus; the vesica has a row of 6-7 cornuti in Catharylla coronata whereas it does not show any cornuti in Catharylla serrabonita and Catharylla tenellus . In the female genitalia of Catharylla coronata, the anterior angle of sternite VIII is not projected whereas it is rounded, projected anterad and covered with short spinules in Catharylla serrabonita, and projected downward in Catharylla tenellus . The anterior apophyses are quadrangular, anvil shaped whereas they are spine like in the other two species.</p><p>Description.</p><p>Male (n = 21) (Fig. 5): Head white with ochreous chaetosemata. Antenna brown, with whitish ochreous scales and patch of brown scales at base. Maxillary palpi light ochreous to ochreous, white tipped. Labial palpi: 1.6-1.85 mm long; light ochreous, white tipped. Thorax white, with ochreous patch at collar. Foreleg coxa white; femur white, dorsally dark brown; tibia and tarsomeres ochreous, distally ringed with brown; midleg and hindleg white to light ochreous, tarsomeres II–V ochreous, upperside brown, with white ringed tips. Forewing length: 10-13 mm; costal margin line thin, light ochreous, apically faded; median transverse line light ochreous, concave on costal half, more or less disrupted; subterminal transverse line ochreous, curving toward base on costal half; R5 vein faintly marked apically with ochreous; outer margin ochreous with 7 pronounced dark brown spots more or less triangular between veins, sometimes connecting; fringes brass colored; underside white ochreous to ochreous, costal margin basally brown; outer margin with pronounced spots. Hindwing white to creamy white, usually with marginal brown spots between Sc+R1, Rs, M1, M2, M3, CuA1 and CuA2, forming more or less continuous line; fringes white; underside light ochreous, with dark brown marginal spots pronounced.</p><p>Tympanal organs (n = 7): Transverse ridge more or less regularly rounded. Tympanic pocket extending faintly beyond transverse ridge, rounded. Tympanic drum glomerular, not reaching transverse ridge.</p><p>Male genitalia (n = 7) (Figs 19, 20): Uncus about 3/4 length of tegumen arms, downcurved; uncus arms basally with ventro-lateral tuft of setae; dorsal furrow pronounced medially with row of few setae on each side; thin, bifid on distal 1/5, slightly grooved, with apex slightly pointed; with shallow cavity ventro-apically. Gnathos arms connecting at 1/3 of length; shaft slightly downcurved, with apex pointing upward. Tegumen arms enlarging progressively toward uncus; tegumen connection about 1/3 arms length. Costa of valva basally narrow, with quadrangular projection, apically narrowing into arm pointing posterad with short tip curved inward; cucullus curved upward in distal 1/3, with apex rounded. Juxta triangular, regularly narrowing toward apex with shallow pockets projected ventro-laterally; with baso-lateral angles curved upward. Transtilla modified into two arms projecting posterad, slightly curved inward in distal 1/4, with longitudinal string of short spines ventrally at base, medially along arms, and at apex, increasing in size from base to apex in factor of about 1 to 4-5. Phallus almost straight, apex dorsally triangular; vesica basally covered with tiny spicules, microspicules barely visible all along vesica, also with row of 5-6 straight, short spine-like cornuti wider at their base.</p><p>Female (n = 4): Labial palpi: 1.6-2.2 mm long. Forewing length 14-16 mm. Frenulum triple.</p><p>Female genitalia (n = 4) (Fig. 38): Papillae anales straight, thick. Posterior apophyses 0.3-0.5 × length of papillae anales, wide at base, about half of length of papillae. Intersegmental membrane between segment VIII and IX covered with microspines. Sternite VIII laterally about 1/3 longer than tergite VIII. Sternite VIII formed by 2 lobes regularly narrowing downward into triangle, not connected ventrally, densely covered with spinules, with spinules longer ventrally. Anterior apophyses about 0.05 × length of papillae anales, quadrangular, anvil shaped. Anterior margin of sternite VIII latero-dorsally strongly sclerotized, thicker; posterior margin with dorsal line of setae. Sterigma membranous, covered with spinules. Ductus bursae regularly enlarging into corpus bursae, basally directed downward. Corpus bursae more or less rounded, faintly delimited from ductus bursae, with one oval signum.</p><p>Distribution.</p><p>The species occurs in Brazil in the following states: Bahia, Espirito Santo, Paranà, Rio de Janeiro, Santa Catarina, Saõ Paulo (Fig. 45).</p><p>Etymology .</p><p>The name comes from the latin coronatus, a, um: crowned, referring to the longitudinal string of short spines of the transtilla in the male genitalia.</p><p>Notes.</p><p>Based on our combined phylogenetic analysis, Catharylla coronata is the sister species of the Catharylla tenellus + Catharylla serrabonita pair (Fig. 42).</p></div>	https://treatment.plazi.org/id/C575A3423350B2EB56556E02A23B7179	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Leger, Theo;Landry, Bernard;Nuss, Matthias;Mally, Richard	Leger, Theo, Landry, Bernard, Nuss, Matthias, Mally, Richard (2014): Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae). ZooKeys 375: 15-73, DOI: http://dx.doi.org/10.3897/zookeys.375.6222, URL: http://dx.doi.org/10.3897/zookeys.375.6222
B2474C9B6617ED1E9BF1ACA677F29A5C.text	B2474C9B6617ED1E9BF1ACA677F29A5C.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Catharylla serrabonita T. Leger & B. Landry	<div><p>Catharylla serrabonita T. Leger &amp; B. Landry sp. n. Figs 6, 21-26, 39, 45, 46</p><p>Type material.</p><p>Holotype. ♂, with labels as follows: "BRASIL: BA, Camacan | Res[erva]. Serra Bonita | 15°23'S, - 39°33'W, | 800m, 06.iv.2011 | B. Landry, V. Becker"; "HOLOTYPE | Catharylla serrabonita | T. Léger &amp; B. Landry" [red label]. Deposited in Becker Collection.</p><p>Paratypes. 21 ♂, 1 ♀. BRAZIL: 5 ♂ (1 used for DNA barcoding BC MTD 01843, 1 with genitalia on slide BL 1745), Espírito Santo, Linhares, 40m, 25-30.i.1998 (V. O. Becker n°113929) (Becker Coll., USNM); 2 ♂, 1 ♀ (♀ with genitalia on slide BL 1759) with same except 20-29.ii.1992 (V. O. Becker n°81552) (Becker Coll., USNM); 2 ♂ with same data as holotype except 05-09.iv.1992 (V. O. Becker n°82486) (USNM); 10 ♂ (1 in alcohol, thorax used for DNA sequencing LEP 979, genitalia on slide TL 7, wing on slide TL 8) Bahia, Camacan, Serra Bonita Reserve, 15°23'S, 39°33'W, 800 m, B. Landry, V. O. Becker, 1.iv.2011 (1 ♂), 2.iv.2011 (2 ♂), 3.iv.2011 (1 ♂, genitalia on slide BL 1776), 5.iv.2011 (3 ♂), 6.iv.2011 (1 ♂), 7.iv.2011 (1 ♂) (MHNG); 1 ♂ with same data except vii.2010 (V. O. Becker) (Becker Coll.); 1 ♂ (used for DNA sequencing and barcoding LEP 970, BC MTD 01887, genitalia on slide TL 6) Bahia, Porto Seguro, A. d’Ajuda, 16°27'S, 39°03'W, 20 m, 12.vii.2009 (V. O. Becker n°144140) (Becker Coll.).</p><p>COI barcode sequence of holotype LEP 979 (516 bp): TAGTTGGAACATCATTAAGACTATTAATTCGAGSAGAGTTAGGGAATCCTGGATCTCTTATTGGAGATGATCAAATTTATAATACTATTGKAACAGCTCATGSATTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAACTGACTAGTTCCATTAATATTAGGAGCCCCAGACATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTACTCCCCCCCTCTTTAACCCTTTTAATTTCCAGAAGAATTGTAGAGAATGGAGCTGGAACAGGATGAACGGTTTACCCCCCCCTTTCATCTAATATTGCTCATAGKGGAAGATCTGTAGATTTAGCAATTTTTTCTCTTCATTTAGSAGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCGTTATTTGTCTGATCAGTTGGTATTACAGCTTTACTCCTTCTTTTATCTTTAC</p><p>Diagnosis.</p><p>From Catharylla coronata and Catharylla tenellus, Catharylla serrabonita can be separated by the zigzagging median transverse line with the short triangular dent at CuA2 and the pronounced creamy color of the hindwing. The male genitalia provide the best discriminant characters: in Catharylla serrabonita, the transtilla forms a pair of sclerotized arms bent inward in distal 1/4 and with a string of long spines of same length medially along it, whereas it forms a pair of short, narrow sclerotized arms with pointed tips projecting posterad, and with a pair of brushes directed medio-ventrally in Catharylla tenellus, and two sclerotized arms slightly bent inward distally, with a row of short spines increasing in size from base to apex in Catharylla coronata, and the juxta is apically narrow and pointed whereas it is triangular and regularly narrowed in Catharylla coronata and Catharylla tenellus . In female genitalia, the anterior angle of sternite VIII is projected anterad into a rounded protrusion covered with short spinules in Catharylla serrabonita, whereas it is projected downward in Catharylla tenellus and it is not projected in Catharylla coronata .</p><p>Description.</p><p>Male (n = 21) (Fig. 6): Head white with ochreous chaetosemata. Antenna brown with whitish-ochreous scales and patch of brown scales at base. Maxillary palpus light ochreous,with patches of dark brown scales at 1/3 and 2/3, white tipped. Labial palpus: 1.7-2.5 mm long; light ochreous, white tipped. Thorax white, with ochreous patch at collar. Foreleg coxa white; femur white, dorsally dark brown; tibia and tarsomeres ochreous, distally ringed with brown. Midleg and hindleg white to light ochreous; tarsomeres II–V ochreous, brown on upperside, with white ringed tips. Forewing length: 10-14 mm; costal line ochreous; median transverse line ochreous to brown, zigzagging with short brown pronounced spot at M1 and short triangular dent at CuA2; subterminal transverse line ochreous to brown, regularly curved up to CuA2, then curved again; R5 faintly marked apically with ochreous; outer margin ochreous with 7 more or less triangular and connected dark brown spots between veins; fringes brass colored; underside ochreous, outer margin with pronounced spots. Hindwing cream-coloured, usually with more or less connected marginal brown spots between Sc+R1, Rs, M1, M2, M3, CuA1 and CuA2; fringes white; underside light ochreous, with marginal spots pronounced.</p><p>Tympanal organs (n = 4): Transverse ridge more or less rounded, medially slightly flattened. Tympanic pocket extending faintly beyond transverse ridge, rounded. Tympanic drum glomerular, not reaching transverse ridge.</p><p>Male genitalia (n = 4) (Figs 21-26): Uncus about as long as tegumen arms, downcurved; uncus arms connecting basally, with ventro-lateral tuft of setae at base; dorsal furrow pronounced medially with row of few hairs on each side; apex rounded, slightly indented medially, slightly convex ventro-apically. Gnathos arms connecting at 1/3; main shaft slightly downcurved with apex pointing upward. Tegumen arms regularly enlarging toward apex, connection at about 4/5 length of arms. Costa with apically rounded arm pointing postero-dorsally; cucullus curved upward in distal 1/3, with apex rounded. Juxta triangular, narrowing in distal 1/4 with bell-shaped ventro-lateral projections, regularly curved with apex horizontally straightened; baso-lateral angles curved upward. Transtilla with two very large sclerotized arms projecting posterad, bent inward in apical 1/4, with longitudinal string of long spines medially. Phallus slightly S-shaped, with apex dorsally sclerotized; vesica covered with microspicules, without cornuti.</p><p>Female (n = 1): Labial palpi: 1.9 mm long. Forewing length: 14 mm. Frenulum triple.</p><p>Female genitalia (n = 1) (Fig. 39): Papillae anales straight, thick. Posterior apophyses 0.4 × length of papillae anales, narrow, wider at base. Intersegmental membrane between segment VIII and IX covered with microspines. Sternite VIII laterally about 5/3 length of tergite VIII; posterior margin of tergite VIII with line of setae; sternite VIII forming 2 triangular lobes regularly narrowing downward, not connected, densely covered with short spinules of same length; anterior angle of sternite VIII slightly projected anterad, rounded, covered with short spinules of same length. Anterior apophyses 0.03 × length of papillae anales. Sterigma membranous, covered with spinules. Ductus bursae about 3 × length of corpus bursae, narrow, basally directed downward and then bent upward. Corpus bursae elongate, ovoid, with one tiny signum.</p><p>Distribution.</p><p>The species occurs in Brazil (Bahia, Espirito Santo) (Figs 45 &amp; 46).</p><p>Etymology.</p><p>The name comes from that of the Serra Bonita Reserve founded by Vitor O. Becker and Clemira de Souza. It is managed by Instituto Uiraçu in the State of Bahia, Brazil.</p><p>Notes.</p><p>Serra Bonita Reserve is located in the Atlantic Forest, in a hilly region of cacao plantations and scattered forest. Adults came late to light, usually after 23:00. Our molecular analysis of the COI barcode sequences highlighted that specimens from Serra Bonita respectively show 3.24 and 2.21 % base differences with those of Porto Seguro and Linhares. This divergence is possibly associated with slight morphological differences in male genitalia as shown in Figs 23-26. No females were found at Serra Bonita.</p></div>	https://treatment.plazi.org/id/B2474C9B6617ED1E9BF1ACA677F29A5C	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Leger, Theo;Landry, Bernard;Nuss, Matthias;Mally, Richard	Leger, Theo, Landry, Bernard, Nuss, Matthias, Mally, Richard (2014): Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae). ZooKeys 375: 15-73, DOI: http://dx.doi.org/10.3897/zookeys.375.6222, URL: http://dx.doi.org/10.3897/zookeys.375.6222
B6C5D5999FE042B1A94EB5B1179641C2.text	B6C5D5999FE042B1A94EB5B1179641C2.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Catharylla mayrabonillae T. Leger & B. Landry	<div><p>Catharylla mayrabonillae T. Leger &amp; B. Landry sp. n. Figs 7, 30, 31, 40, 44</p><p>Type material.</p><p>Holotype. ♂, with labels as follows: "Col. BECKER | 101668"; "ECUADOR: NAPO | Misahualli | 450m xii.1992 | V.O.Becker Col"; "HOLOTYPE | Catharylla | mayrabonillae | Léger &amp; Landry" [red label]. Deposited in Becker Collection.</p><p>Paratypes. 16 ♂, 37 ♀. BRAZIL: 1 ♀ (genitalia on slide BL 1729), [Acre] Rio Branco, 1924 (Dengler) (SMNS); 2 ♀, Amazonas, Manaus, Reserva Ducke, AM-010, km 26, 2°55'S, 59°59'W, 15.xii.1993, U[ltra]V[iolet] Light (J. B. Sullivan &amp; R. W. Hutchings) (USNM); 1 ♂ (genitalia on Pyralidae Brit. Mus. Slide No. 11341), Amazonas, Fonte Boa, ix.1906 (S. M. Klages) (BMNH); 1 ♀ (genitalia on slide BL 1713), Federal District, Estaçao Florestal, Cabeca do Vedao, 1100m, 18.x.1971 (E.G., I. &amp; E.A. Munroe) (CNC); 2 ♂, Maranhão, Feira Nova, Faz[enda]. Retiro, 480m, 07°00'S, 46°26'W, 1-3.xii.2011 (V. O. Becker n°148263) (Becker Coll.); 2 ♀, Pará, Belém, 20m, i.1984 (V. O. Becker n°46981) (Becker Coll.); 1 ♀, Pará, Capitao Poco, 25-31.i.1984 (V. O. Becker n°97880) (Becker Coll.); 1 ♂, Rondonia, Cacaulãndia, 140m, xi.1991 (V. O. Becker n°79592) (Becker Coll.); 1 ♀, Rondonia, 62km S[outh] Ariquemes, Fazenda Rancho Grande, 165m, 10°32'S, 62°48'W, 18-26.iv.1991 (R. Leuschner) (USNM). COLOMBIA: 1 ♂, Valle, J[un]ct[ion]. Old B’ [uena]v[en]tura R[oa]d. and Rio Dagua, 50m, 8.ii.1989 (J. B. Sullivan) (USNM). COSTA RICA: 1 ♀ (used for DNA Barcoding by Janzen, 07-SRNP-113921), Alajuela, Area de Conservacion Guanacaste, Estacion Caribe, 12.xi.2007 (S. Rios &amp; H. Cambronero) (INBio); 1 ♀, Alajuela, Area de Conservacion Guanacaste, Rio Negro, 25.i.2009 (H. Cambronero &amp; F. Quesada) (INBio); 2 ♂ (one used for DNA sequencing LEP 966, with genitalia on slide TL 3, other used for DNA sequencing LEP 967, with genitalia on slide TL 4), Alajuela, San Carlos, Arenal National Park, Send[ero] Pilón, Rio Celeste, 700m, light trap, 17-19.x.2001 (G. Rodriguez) (INBio); 1 ♂, Prov[incia] Guanacaste, F[in]ca Pasmompa, Est[acion] Pitilla, 5km SO S[an]ta Cecilia, 400m, xii.1990 (P. Rios &amp; C. Moraga) (INBio). ECUADOR: 4 ♀ with same data and deposition as holotype; 4 ♂, 8 ♀ (1 ♂ used for DNA barcoding BC MTD 01844) with same data (USNM); 1 ♀ (genitalia on slide BL 1726, used for DNA sequencing and barcoding LEP 969, BC MTD 1707), Napo, 6km NW Tena, Lumu Caspi, 0°54'37"S, 77°49'32"W, 590m, 29.ix.2002 (Schouten Coll.); 1 ♀ (genitalia on slide BL 1715, used for DNA sequencing and barcoding LEP 968, BC MTD 1706), Pastaza, 1km N Santa Clara, 1°16'02"S, 77°52'57"W, 630m, 28.ix.2002 (Schouten Coll.). FRENCH GUIANA: 1 ♂, 4 ♀ (♂ genitalia on Pyralidae Brit. Mus. Slide No 7816, ♀ genitalia on slides BL 1720, BL 1725, and Pyralidae Brit. Mus. Slides No. 5953 and 19020), Saint Jean de Maroni (E. Le Moult) (BMNH); 2 ♀, Piste Nancibo, km 6, 4°41'N,; 52°25'W, in logged rain forest, at 125W[atts] mer[cury]-vapor light and 15W[atts] U[ltra]V[iolet], 11.i.1985 (J.[-]F. Landry) (USNM); 1 ♂, Roura, Montagne des Chevaux, xii.2008 (S. Delmas) (MHNG); 1 ♂ (genitalia on slide Pyralidae Brit. Mus. Slide No 7792), Cayen[ne] (BMNH). GUYANA: 1 ♀ (genitalia on slide BL 1723), Omai, vi.1908 (S. M. Klages) (BMNH); 1 ♀ (genitalia on slide BL 1722), Potaro i.1908 (S. M. Klages) (BMNH). PANAMA: 1 ♀, Rio Trinidad, 12.iii [no year data] (A. Busck) (USNM). PERU: 1 ♂ (genitalia on slide BL 1724), Agnaytia, Huallaga, 400m, ix.1961 (F. H. Walz) (CNC); 1 ♀ (genitalia on slide GS-6908-SB), Yurimaguas, Huallaga 14.iv.[19]20 (CMNH). SURINAME: 2 ♀ (genitalia on slides BL 1727 and BL 1728), Kabo, 5°16'N, 55°44'W, Saramaca, black light, respectively 15-16.iii.1983 and 13-14.i.1983 (K.E.Neerling) (Schouten Coll.); 1 ♀ (genitalia on slide BL 1710), Sipaliwini Distr[ict]., Tibiti area, Kabo Creek, partly swampy primary forest on hilly slopes, ca 2km from river, vi.1989 (J. Beerlink) (Schouten Coll.).</p><p>Other specimen examined. 1♀ (used for DNA sequencing Lep 1126), Peru, Huánuco, Rio Llullapichis, Panguana, 74,945°W / 9,614°S, 23.9.-10.10.2011 (SMTD).</p><p>COI barcode sequence of paratype 07-SRNP-113921 (654 bp): ACATTATATTTTATTTTCGGGATTTGAGCAGGTATAGTAGGAACTTCACTTAGATTATTAATTCGTGCTGAATTAGGTAACCCTGGCTCTCTTATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATCGGTGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGGGCACCAGATATAGCTTTCCCTCGAATAAATAACATAAGATTTTGATTATTACCACCATCATTAACTCTTTTAATTTCTAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTTTATCCACCTTTATCATCTAATATTGCCCATGGGGGTAGATCTGTAGATTTAACAATTTTTTCATTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCATTTGATCAATTATCATTATTTATTTGATCAGTAGGAATTACTGCTTTACTTTTATTATTATCATTACCAGTTTTAGCTGGGGCTATTACTATACTTTTAACTGATCGAAATCTTAATACATCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTA</p><p>Diagnosis.</p><p>The best discriminant characters externally between the two species of the mayrabonillae group are the shape of the forewing outer margin, which is slightly produced apically in Catharylla mayrabonillae and not produced in Catharylla paulella, and the forewing median transverse line with two strongly pronounced spots at 1/3 and 2/3 in Catharylla paulella, whereas these spots are lacking in Catharylla mayrabonillae . The hindwing of Catharylla mayrabonillae has a faded subterminal transverse line on costal half whereas the hindwing of Catharylla paulella lacks this marking. In male genitalia, the heavily sclerotized sacculus bears a dorso-lateral sclerotized string of short spines on distal 1/4 whereas the two processes of the costa are S-shaped in Catharylla paulella, and the apex of the phallus is trifid, rounded medially, shortly triangular laterally, whereas it is simply rounded in Catharylla paulella . In female genitalia, the sterigma forms double rounded cavities with a mustachio-shape arrangement of short spines in ventral view, and the ductus bursae is wide, progressively widening toward corpus in Catharylla mayrabonillae, whereas the sterigma forms a pair of shallow rounded pockets on each side of middle and the ductus bursae is narrow, with the rounded corpus bursae clearly differentiated from it in Catharylla paulella .</p><p>Description.</p><p>Male (n = 17) (Fig. 7): Head with light ochreous chaetosemata. Antenna brown, with white scales dorsally and patch of dark brown scales at base. Maxillary palpus light ochreous, ringed with dark brown at 2/3; white tipped. Labial palpus: 1-1.4 mm; white, with patch of dark brown scales at 1/3 and 2/3 laterally. Thorax with patch of light ochreous scales at collar. Foreleg coxa whitish brown, femur white, dorsally ashen brown, tibia and tarsomeres ochreous, distally ringed with dark brown. Midleg femur white, tibia light ochreous, basally brown, tarsomeres II–V ochreous with tips ringed white. Hindleg white, except tarsomeres, as in midleg. Abdomen dull white. Forewing length: 7.5-8.5 mm; with apex slightly produced; costal line thin, ochreous or white in basal half, white in apical half; median transverse line ochreous, slightly undulated; subterminal transverse line ochreous; transverse lines enlarging into brown spot on costal margin with ochreous bar on costa following subterminal transverse line; terminal sector with light ochreous between veins, margin with thin, dark brown line from apex to CuA1, with two dark brown spots in cubital sector, with spot between CuA1 and CuA2 slightly displaced toward base; fringes brass colored; underside light ochreous with some brownish scales, with thin brown margin. Hindwing white with thin transverse subterminal line faded ochreous, in continuity with forewing median transverse line; outer margin line pronounced, dark brown; underside dull white with thin faded brown margin; fringes white.</p><p>Tympanal organs (n=7): Transverse ridge regularly rounded, medially slightly flattened. Tympanic pockets broadly rounded, extended widely beyond transverse ridge, connected medially at base of praecinctorium. Tympanic drum bean-shaped, elongated, extended beyond tympanic pockets.</p><p>Male genitalia (n = 7) (Figs 30, 31): Uncus thick and wide, about 2/5 length of tegumen arms, densely setose, with shortly projecting apex dorsally rounded. Gnathos reaching about 1/4 longer than uncus; arms wide, joining at 2/5 of length; distal 2/5 at angle of about 85°. Tegumen almost regularly narrow, joined in last 1/4. Cucculus narrow, shorter than sacculus, apically rounded; sacculus greatly enlarged, thickly sclerotized, directed upward, then apically straight, slightly narrowing toward apex, laterally with string of short spines and 2-3 longer basal spines pointing downward; costal arm of valva directed upward, located at about 1/3 of costal margin, thin, strongly sclerotized, slightly curved. Vinculum arms narrow; saccus short and wide, tongue shaped, projecting posterad apically. Juxta elongate, distal 1/4 narrowed with rounded tip; wide base with ear-like lobes laterally and baso-lateral angle projected anterad. Phallus slightly bent sideways in distal 1/4, with trifid sclerotized apex rounded medially and shortly triangular laterally; vesica basally covered with tiny spicules, microspicules barely visible all along, with long spine-like, down-curved cornutus of about 2/5 length of phallus.</p><p>Female (n = 37): Labial palpi length: 1.1-1.3 mm. Forewing length: 9.5-10.5 mm; frenulum triple.</p><p>Female genitalia (n = 16) (Fig. 40): Papillae anales strongly curved in lateral view; sclerotized line along papillae expanding ventrally into triangle. Posterior apophyses 0.35-0.45 × length of papillae anales. Tergite VIII about 1/3 length of sternite VIII; postero-dorsal margin with few setae of moderate length; anterior apophyses 0.03-0.1 × papillae anales; sternite VIII with patches of minute setae antero-ventrally on each side of bare median band. Sterigma forming double rounded cavities with mustachio-shaped arrangement of short spines (in ventral view); remaining cavity wall with tiny spines. Ductus bursae short and wide, enlarged near middle; partly sclerotized on right side of enlargement and posterior section. Corpus bursae circular to elongate, about as long as tergite VII; single signum faintly pronounced.</p><p>Distribution.</p><p>The species has been found so far in Panama, Costa Rica, Colombia, Venezuela, Guyana, Suriname, French Guiana, Ecuador, Peru and Brazil (Acre, Amazonas, Distritò Federal, Pará, Rondônia) (Fig. 44). It is the most widespread species of Catharylla and the only one so far found in Central America and in Venezuela, Columbia, Ecuador and Peru.</p><p>Etymology.</p><p>Catharylla mayrabonillae is named in honor of Ms. Mayra Bonilla of San Jose, Costa Rica, in recognition of her artistic portrayal of the biodiversity and ecosystems of Costa Rica and her many years of support for the existence of the rain forest in Area de Conservacion Guanacaste.</p><p>Notes.</p><p>The relatively strong COI barcode divergence of 4.34% between samples LEP 1126 from Peru and 07-SRNP-113921 from Costa Rica (Table 5) is notable but it is not associated with morphological variation.</p></div>	https://treatment.plazi.org/id/B6C5D5999FE042B1A94EB5B1179641C2	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Leger, Theo;Landry, Bernard;Nuss, Matthias;Mally, Richard	Leger, Theo, Landry, Bernard, Nuss, Matthias, Mally, Richard (2014): Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae). ZooKeys 375: 15-73, DOI: http://dx.doi.org/10.3897/zookeys.375.6222, URL: http://dx.doi.org/10.3897/zookeys.375.6222
7FEE41A39E782EDF569CC181B49FB278.text	7FEE41A39E782EDF569CC181B49FB278.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Catharylla paulella Schaus 1922	<div><p>Catharylla paulella Schaus, 1922 Figs 8, 10, 32, 33, 41, 44</p><p>Catharylla paulella Schaus, 1922: 131; Bleszynski and Collins 1962: 226; Bleszynski 1967: 97; Munroe 1995: 35; Nuss et al. 2013.</p><p>Type material.</p><p>Holotype. ♀, with labels as follows: "Sao Paulo | S.E. Brazil."; "Collection | W[illia]mSchaus"; "Type No. | 25533 | U.S.N.M." [orange label]; "SLIDE | SB ♀ | No.4641" [light blue label]; "Catharylla | paulella | type Sch[au]s" [hand written]; "Genitalia Slide | By SB | USNM 111,535" [green rectangular label with thin black line submarginally]. Deposited in USNM.</p><p>Other specimens examined. 2 ♂, 7 ♀. BOLIVIA: 2 ♂ (genitalia on slides GS-6652-SB and Pyralidae Brit. Mus. Slide No. 15890), Prov.[incia] del Sara, 450 m, iv.1910 (J. Steinbach) (CMNH, BMNH). BRAZIL: 1 ♀ (genitalia on slide BL 1752), Federal District, Planaltina, 15°35'S, 47°42'W, 1000 m, 3.xi.1977 (V. O. Becker n°22055) (Becker Coll.), 1 ♀ (genitalia on slide BL 1751) with same locality, 16.x.1990 (V. O. Becker n°96854) (Becker Coll.); 1 ♀, Maranhão, Feira Nova, Faz[enda]. Retiro, 480m, 07°00'S, 46°26'W, 1-3.xii.2011 (V. O. Becker n°148263) (Becker Coll.); 1 ♀ (genitalia on slide BL 1712), Mato Grosso, Urucum, 15 miles S[outh]. of Columbá, 650 f[ee]t, 19. iv. [19]27, at light (C. L. Collenette) (BMNH); 1 ♀, Parà, Belém, 20m, i.1984 (V. O. Becker n°46993) (Becker Coll.); 1 ♀ (genitalia on Pyralidae Brit. Mus. Slide N° 17692), São Paulo (BMNH); 1 ♀ (used for DNA sequencing and barcoding LEP 965, BC MTD 1705, genitalia on slide TL 5), São Paulo, São Luiz do Paraitinga, 23°20'S, 45°06'W, 900 m, 13-20.iii.2001 (V. O. Becker n°132357) (Becker Coll.).</p><p>COI barcode sequence of specimen LEP 965 (654 bp): ACATTATATTTTATTTTTGGAATTTGAGCAGGTATACTAGGAACTTCACTTAGAT TATTAATTCGTGCTGAATTAGGTAATCCTGGATCTCTTATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGTGCACCAGATATAGCTTTCCCTCGAATAAATAATATGAGATTTTGATTATTACCCCCATCATTAACTCTTTTATTTT ?TAGAAGAATTGTCGAAAATGGAACTGGAACAGGATGAACAGTTTACCCACCCTTATCATCCAATATTGCTCATAGAGGTAGATCAGTAGATCTAGCAATTTTTTCTTTACATTTGGCTGGAATTTCATCAATCTTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAATTAATAATTTATCTTTTGATCAATTATCATTATTTATTTGATCTGTAGGTATTACAGCTTTACTTTTATTATTATCATTACCAGTTCTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATCTTAATACATCATTTTTTGATCCTGCAGGAGGAGGTGATCCTATCTTGTATCAACATTTA</p><p>Diagnosis.</p><p>This species can be easily separated from the other Catharylla species by the forewing median transverse line with two strongly pronounced spots at 1/3 and 2/3. The forewing is also sparkled with dark brown scales, which is unique in the genus. In male genitalia, the two S-like projections of the costal arm of the valva discriminate this species from the other species of Catharylla . In female genitalia, the sterigma forms a pair of shallow rounded pockets on each side of middle, and the ductus bursae is narrow, with the rounded corpus bursae clearly differentiated from it in Catharylla paulella, whereas it forms double rounded cavities with a mustachio-shape arrangement of short spines in ventral view, and the ductus bursae is wide, progressively widening toward corpus in Catharylla mayrabonillae .</p><p>Redescription.</p><p>Male (n = 2): Head with ochreous chaetosemata. Antenna ochreous with white scales, with patch of dark brown scales at base. Maxillary palpus light ochreous, white tipped. Labial palpus: 1.4-1.7 mm long, light ochreous, white tipped. Thorax light ochreous at collar. Foreleg coxa whitish ochreous, femur light ochreous, dorsally ochreous; tibia and tarsomeres greyish brown, distally ringed with dark brown. Midleg and hindleg whitish ochreous; midleg tibia basally brown, hindleg tibia white; midleg and hindleg tarsomeres with white tips. Forewing length: 7-8 mm; costal line thin, brown or dirty white; median transverse line ochreous, with two dark brown strongly pronounced spots at 1/3 and 2/3; subterminal transverse line thin, ochreous, with small triangular spot on costal margin; with ochreous bar on costal margin following subterminal transverse line; outer margin ochreous with short dark brown lunules or dashes; fringes brass colored; underside light ochreous with brownish suffusion; with pronounced marginal spots. Hindwing white; outer margin with thin ochreous line in apical half; fringes white; underside dull white with dark brown marginal spots more or less connected on apical half.</p><p>Male genitalia (n = 2) (Figs 32, 33): Uncus almost straight, densely setose, about 1/4 length of tegumen arms. Gnathos with arms joining at 3/5, then directed upward at slightly less than 90° angle; apically narrowly rounded. Tegumen arms regularly widening toward uncus, connecting at about half their length. Cucculus of medium width, slightly curved upward in distal 1/4; costal arm of valva divided with short spatula at base and S-shaped projection with rounded apex apically. Juxta triangular with distal third narrower, apically rounded, with baso-lateral narrow, triangular projections pointing anterad. Phal lus with apex more thickly sclerotized, with blunt apical margin, with short triangular ventral projection; vesica covered on basal 1/4 with tiny spicules, with barely visible microspicules all along, with one wide and curved cornutus at about 1/4 length of phallus.</p><p>Female (n = 7) (Figs 8, 10): Labial palpi: 1.4-1.7 mm long; forewing length: 9-9.5 mm; frenulum triple.</p><p>Tympanal organs (n = 5) (Fig. 10): Transverse ridge medially straight. Tympanic pockets not reaching beyond transverse ridge, rounded. Tympanic drum bean shaped, somewhat oval, just reaching transverse ridge.</p><p>Female genitalia (n = 5) (Fig. 41): Papillae anales ventrally slightly projected; sclerotized line at base enlarging medially to triangular shape covered by minute punctuation. Posterior apophyses 0.4-0.5 × length of papillae anales, narrow, tubular, with rounded tips. Tergite VIII short, about half of length of greatly enlarged sternite VIII. Anterior apophyses 0.05-0.1 × length of papillae anales. Lamella antevaginalis of sterigma dorsally covered with minute spicules; pair of shallow rounded pockets on each side of middle opened posterad. Base of ductus bursae sclerotized, forming circular membranous and narrow pocket. Corpus bursae regularly rounded, without signum.</p><p>Distribution.</p><p>The species has been found in Brazil (Federal District, Maranhão, Mato Grosso, Pará, Saõ Paulo) and in Bolivia (Fig. 44).</p><p>Notes.</p><p>The original description doesn’t mention the original number or sex of the specimens but it is assumed that there was only one. S. Bleszynski gave the new name of Catharylla hibisca to specimens that appear to be Catharylla paulella . The BMNH São Paulo specimen is associated with slide n° 17692, but the genitalia on this slide seem to be wrongly associated, given the inscription "wrong abdomen?" on the label, as well as the size of the abdomen, which is much bigger than those of Catharylla paulella . Therefore, this specimen cannot be identified with certainty. An error is possible in the association of the sexes of this species as there are no series of both sexes from the same locality or other means of associating them with 100% confidence.</p></div>	https://treatment.plazi.org/id/7FEE41A39E782EDF569CC181B49FB278	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Leger, Theo;Landry, Bernard;Nuss, Matthias;Mally, Richard	Leger, Theo, Landry, Bernard, Nuss, Matthias, Mally, Richard (2014): Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae). ZooKeys 375: 15-73, DOI: http://dx.doi.org/10.3897/zookeys.375.6222, URL: http://dx.doi.org/10.3897/zookeys.375.6222
