identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
137787C07C7F13791ABFFEDFB7DEFDF6.text	137787C07C7F13791ABFFEDFB7DEFDF6.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Kuwayamachrysa Tsukaguchi & Tago 2018	<div><p>Genus Kuwayamachrysa Tsukaguchi &amp; Tago, 2018</p><p>Kuwayamachrysa Tsukaguchi &amp; Tago, 2018: 71 .</p><p>Type species: Chrysopa kichijoi Kuwayama, 1936, by original designation.</p><p>Diagnosis. Medium-sized green lacewings; body color mostly greenish. Head with black markings on lateral clypeus and gena, frons marked or not; palpus tapered apically, mandibles broad, asymmetrical. Pronotum with brown stripes laterally, meso- and metanotum unmarked. Sterna with red stripe, tergum marked or not. Male genitalia with asymmetrical gonapsis; tignum absent.</p><p>Distribution. Palearctic and Oriental regions.</p></div>	https://treatment.plazi.org/id/137787C07C7F13791ABFFEDFB7DEFDF6	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Wang, Maozhi;Lai, Yan;Liu, Xingyue	Wang, Maozhi, Lai, Yan, Liu, Xingyue (2025): The green lacewing genus Kuwayamachrysa Tsukaguchi & Tago, 2018 from China, with description of two new species based on morphological and molecular evidence. Zootaxa 5570 (1): 138-150, DOI: 10.11646/zootaxa.5570.1.6, URL: https://doi.org/10.11646/zootaxa.5570.1.6
137787C07C7F13781ABFFD55B626F8E4.text	137787C07C7F13781ABFFD55B626F8E4.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Kuwayamachrysa kichijoi (Kuwayama 1936)	<div><p>Kuwayamachrysa kichijoi (Kuwayama, 1936)</p><p>(Figs 1, 2)</p><p>Chrysopa kichijoi Kuwayama, 1936: 811 . Type locality: Japan (Hokkaido).</p><p>Mallada qinlingensis Yang, 1989: 23 . Type locality: China (Shaanxi: Qinling). syn. nov.</p><p>Diagnosis. Forewing veins mostly brown, but longitudinal veins pale; hind wings with costal crossveins, radial crossveins and gradate crossveins brown. Abdomen with greenish terga and red stripe on sterna.</p><p>Material examined. CHINA, Shanxi: 1♀, Yuncheng, Huangguman Reserve (<a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=35.39&amp;materialsCitation.latitude=111.948" title="Search Plazi for locations around (long 35.39/lat 111.948)">Dzd</a> 幔保护区), 111.9480°N, 35.3900°E, 1299 m, 23.VII.2020, Rongrong Shen, Jingyu Wu (CAU) ; 5♂ 8♀, Yuncheng, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=111.975&amp;materialsCitation.latitude=35.46" title="Search Plazi for locations around (long 111.975/lat 35.46)">Lishan Reverse</a> (历山保 护区), 35.4600°N, 111.9750°E, 1316 m, 22-23.VII.2020 (L), Xingyue Liu, Rongrong Shen, Jingyu Wu (CAU) ; Shaanxi: 2♂ 6♀, Ankang, Ningshan, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=108.4453&amp;materialsCitation.latitude=33.4343" title="Search Plazi for locations around (long 108.4453/lat 33.4343)">Huoditang</a> (火地Oi), 33.4343°N, 108.4453°E, 1528 m, 19.VII.2018 (L), Yingnan He (CAU) ; 5♂ 11♀, Zhouzhi, Houzhenzi (ñḃŦ), <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=107.7596&amp;materialsCitation.latitude=33.7933" title="Search Plazi for locations around (long 107.7596/lat 33.7933)">Laoxiancheng</a> (Ɩ县µ), 33.7933°N, 107.7596°E, 1777 m, 14.VII.2018 (L), Yingnan He (CAU) ; 1♂ 2♀, Huyi (IJẽ), <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=108.5742&amp;materialsCitation.latitude=33.7833" title="Search Plazi for locations around (long 108.5742/lat 33.7833)">Changping</a> (K坪), 33.7833°N, 108.5742°E, 456 m, 9-13.VII.2020 (L), Bing Zhang (CAU) ; 2♂ 4♀, Weibin (DZ滨), <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=107.0163&amp;materialsCitation.latitude=34.2659" title="Search Plazi for locations around (long 107.0163/lat 34.2659)">Dasanguan</a> (kü关), 34.2659°N, 107.0163°E, 805 m, 6-8.VII.2020 (L), Bing Zhang (CAU) ; 1♂ 1♀, Foping, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=107.7677&amp;materialsCitation.latitude=33.5945" title="Search Plazi for locations around (long 107.7677/lat 33.5945)">Daguping</a> (k古坪), 33.5945°N, 107.7677°E, 1329.2 m, 24.VII.2014 (L), Xiumei Lu (CAU) ; Taiwan: 1♂, Huali, Xiulin, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=121.3407&amp;materialsCitation.latitude=24.19" title="Search Plazi for locations around (long 121.3407/lat 24.19)">Guanyuan</a> (关®), 24.190°N, 121.3407°E, 2376 m, 19.VI.2019, Yuchen Zheng (CAU) ; 2♂, Hualian, Xiulin, Guanyuan (关®), 2376 m, 16.VI.2020, Yuchen Zheng (CAU) .</p><p>Distribution. China (Shanxi, Shaanxi, Taiwan), Japan (Aomori, Iwate, Fukushima, Saitama, Yamanashi, Nagano), South Korea (Gangwon), Russia (Primorskiy).</p><p>Remarks. The species Apertochrysa qinlingensis was originally described by Yang (1989) as having the following characters: the presence of markings on gena, the presence of two or three series of gradate crossveins, the red stripes on the sterna 2-7, the absence of the tignum, and the asymmetric gonapsis in the male genitalia, which are largely consistent to the diagnostic characters of K. kichijoi . Although the holotype of A. qinlingensis is lost, based on the specimens we collected from the type locality of this species and the illustrations given by Yang (1989), we confirm that they are A. qinlingensis and this species should be treated as a junior synonym of K. kichijoi .</p><p>Apertochrysa joannisi (Navás, 1910) is another potential synonym of K. kichijoi . This species was originally described by Navás (1910) from Shanghai (originally spelled as Chang-Hay), China. Makarkin (1985) recorded this species from eastern Russian and illustrated the Russian specimens, his illustrations show a specialized gonapsis similar to that of K. kichijoi . Therefore, the Russian specimens identified as A. joannisi by Makarkin (1985) probably are K. kichijoi . However, the genital morphology of the type specimen of A. joannisi (a female) from China is unreported. The specimen itself is in the Muséum national d’Histoire naturelle (MNHN) in Paris (Legrand et al. 2008), and any formal taxonomic treatment related to A. joannisi must be made after checking the type of this species.</p><p>DNA barcode sequence</p><p>TCGCGACAATGATTGTTTTCAACTAACCATAAGGATATTGGTACATTATATTTTATTTTTG G TAT T T G AT C T G G AT TA G TA G G TA C TA G T T TA A G T T TAT TA AT T C G A G C T G A AT TA G G T C A A C C A G G T T C AT TA AT T G G T G AT G AT C A A AT T TATA AT G TA AT T G T TA C A G C T C AT G C C T TTATTATAATTTTTTTTATAGTTATACCAATTGTAATTGGGGGTTTTGGTAATTGATTAGTT CCTTTAATATTAGCGGCTCCTGATATAGCCTTTCCTCGAATAAATAATATAAGTTTTTGAA TATTACCCCCTTCTTTAACATTACTTCTTGCTTCTTCTATAGTAGAAAGAGGAGCTGGAA C A G G T T G A A C T G T T TAT C C A C C T C T T T C C T C TA G A AT T G C T C AT G C A G G A G C T T C T G T T GATTTAGCTATTTTTAGTTTACATCTAGCTGGTATTTCTTCAATTTTAGGAGCTGTAAATT TTATTACTACTGTAATTAATATACGACTAAGTTATATAACTTTAGATCGAATACCTCTATTT GTTTGATCTGTTGTTATTACAGCATTATTATTACTTTTATCATTACCTGTATTAGCAGGAGCTATTACTAT TATTAACTGATCGTAATTTAAACACTTCTTTTTTTGA</p></div>	https://treatment.plazi.org/id/137787C07C7F13781ABFFD55B626F8E4	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Wang, Maozhi;Lai, Yan;Liu, Xingyue	Wang, Maozhi, Lai, Yan, Liu, Xingyue (2025): The green lacewing genus Kuwayamachrysa Tsukaguchi & Tago, 2018 from China, with description of two new species based on morphological and molecular evidence. Zootaxa 5570 (1): 138-150, DOI: 10.11646/zootaxa.5570.1.6, URL: https://doi.org/10.11646/zootaxa.5570.1.6
137787C07C79137C1ABFF991B4E8FD03.text	137787C07C79137C1ABFF991B4E8FD03.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Kuwayamachrysa wujiaoensis Wang & Lai & Liu 2025	<div><p>Kuwayamachrysa wujiaoensis sp. nov.</p><p>(Figs 3, 4)</p><p>Diagnosis. Forewing veins mostly brown but longitudinal veins pale; hind wings with costal crossveins and outer gradate crossveins brown. Abdomen red ventrally, red stripes present dorsally.</p><p>Description. Body mostly green, 12.00– 13.80 mm long (Fig. 3A, B).</p><p>Head. 1.30-1.40 mm wide (including compound eyes). Mostly green, with genal markings and lateral markings. Mandibles asymmetrical, broad; labial palpomeres marked black, maxillary palpus black apically, brownish and tapered apically. Antenna shorter than forewing, brownish, pale at base; scape and pedicel greenish, unmarked, flagellar setae arranged in four rings, flagellum yellowish, setae brownish (Fig. 3B, C).</p><p>Thorax. Greenish, pronotum about as long as wide; setae dark, with brown, broad stripes on lateral pronotum; transverse sulci present. A yellowish longitudinal median stripe present on pro-, meso-, and metanotum (Fig. 3B, C).</p><p>Legs. Greenish, unmarked, covered with short black setae; claws curved, brown.</p><p>Forewing. 13.60-15.10 mm long. Wing membrane transparent, rounded apically, tegula unmarked; longitudinal veins mostly greenish, base of anal veins greenish, other veins marked brown. Costa area narrow basally, costal crossveins simple, straight, slightly sinuous on third and fourth crossveins, 16 costal crossveins present; basal subcostal crossvein present, crossveins posteriad pterostigma absent; 12 radial crossveins present; intramedian cell (im) triangular, subdistally connected by 1rp-m crossvein; series of gradate corssveins varied in number, three gradate series of crossveins present in most individuals but two present occasionally, number of gradates (inner/ middle/outer: 6/2/7, or inner/outer: 7/8); basal crossveins of first gradate series not meeting PsM; dcc open, CuP not forked (Fig. 3A).</p><p>Hind wing. Pterostigma greenish, veins greenish, but costal crossveins, anterior half of radial crossveins and outer gradate veins marked brown, inner gradate greenish basally and brownish distally; 12 costal crossveins present; seven crossveins between PsC and PsM; two gradate series of crossveins present, number of gradates (inner/outer): 5/7 (Fig. 3A).</p><p>Abdomen. Greenish; red stripe present on sterna 2-7, brownish markings on terga present; sterna covered with short black setae; spiracles small, round, not enlarged, atria not enlarged (Fig. 3A).</p><p>Male genitalia. Terminalia broad; tergum 9 and ectoprocts fused; ectoproct rounded; dorsal invagination shallow; thick setae on ectoproct absent; sterna 8 and 9 fused, regular, without strong apical setae; gonarcus medially fused, lateral arm expanded; entoprocessus slender, slightly curved, bifurcated and slightly expend; mediuncus closely associated with gonarcus, elongate, laterally expended, mediuncus process absent; gonosaccus robust, with gonosetae and spinellae; parameres absent; numerous gonostae present; gonapsis constituted by a pair of asymmetrical lobes, with lateral lobe expanded and right lobe tapering distad, curved; tignum absent (Fig. 4A, C, D, E, F).</p><p>Female genitalia. Tergum 9 and ectoprocts fused; sternum 7 simple, apically rounded; subgenitale broader than long, attached on a broad membranous structure; spermatheca small, more flat than other; vela thick and elongate; spermathecal twisted (Fig. 4B, G, H).</p><p>Type material. Holotype ♂, CHINA, Sichuan: Muli, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=100.7473&amp;materialsCitation.latitude=27.9624" title="Search Plazi for locations around (long 100.7473/lat 27.9624)">Wujiao</a> (屋¶), 27.9624°N, 100.7473°E, 2823 m, 24.VII.2020 (L), Yuezheng Tu (CAU) . Paratypes: 2♂ 2♀, same data as holotype (CAU) .</p><p>Etymology. The new species is named after its type locality, i.e., Wujiao Village in southwestern Sichuan.</p><p>Distribution. China (Sichuan).</p><p>Remarks. This new species can be differentiated by the red stripes present on terga, and the smaller size of the gonapsis in the male genitalia.</p><p>DNA barcode sequence</p><p>T C G C G A C A G T G AT TAT T T T C A A C TA A C C ATA A G G ATAT T G G TA C AT TATAT T T TAT T T T T G G TAT T T G AT C T G G AT TA G TA G G TA C C A G T T TA A G T T TAT TA AT T C G A G C T G A AT TA G G T C A A C C A G G T T C AT TA AT T G G T G AT G AT C A A AT T TATA AT G TA AT T G T TA C A G C T C AT G C T T T TAT TATA AT T T T C T T TATA G T TATA C C TAT T G TA AT T G G A G G AT T T G G A A A C T G AT TA G T T C C T T TA ATAT TA G C A G C C C C T G ATATA G C T T T C C C T C G A ATA A ATA ATATA A G T T T T T G A AT AT TA C C C C C T T C T T TA A C AT TA C T C C T T G C T T C T T C TATA G T T G A A A G A G G A G C T G G TA C A G G T T G A A C T G T T TAT C C A C C C C T T T C T T C TA G A AT T G C C C AT G C A G G A G C T T C T G T T G AT T TA G C TAT T T T TA G T T TA C AT T TA G C T G G A AT C T C AT C A AT T T TA G G A G C T G TA A AT T T TAT TA C TA C T G TA AT TA ATATA C G T T TA A G T TATATA A C T T TA G AT C G A ATA C C T T TAT T T G T T T G AT C A G T T G T TAT TA C A G C AT TA C T T C T T C TAT TAT C T T TA C C T G TAT TA G C T G G A G C TAT TA C TATAT TAT TA A C A G AT C G TA AT T TA A ATA C T T C T T T T T T T G AT C C T G C A G G A G G A G G A G AT C C A AT T T TATAT C A A C AT T TAT T T T G AT T T T T T G G A C AT C C T G A A G T T TATAT T C T AATTTTACCTGGATTTGTTC</p></div>	https://treatment.plazi.org/id/137787C07C79137C1ABFF991B4E8FD03	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Wang, Maozhi;Lai, Yan;Liu, Xingyue	Wang, Maozhi, Lai, Yan, Liu, Xingyue (2025): The green lacewing genus Kuwayamachrysa Tsukaguchi & Tago, 2018 from China, with description of two new species based on morphological and molecular evidence. Zootaxa 5570 (1): 138-150, DOI: 10.11646/zootaxa.5570.1.6, URL: https://doi.org/10.11646/zootaxa.5570.1.6
137787C07C7A13711ABFFD08B639FA78.text	137787C07C7A13711ABFFD08B639FA78.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Kuwayamachrysa neptuna Wang & Lai & Liu 2025	<div><p>Kuwayamachrysa neptuna sp. nov.</p><p>(Figs 5, 6)</p><p>Diagnosis. Forewing veins mostly brown, but longitudinal veins pale; hind wing pale. Abdomen scarlet ventrally, scarlet markings present on terga.</p><p>Description. Body. Mostly green, 12.70-15.10 mm long (Fig. 5A, B, E).</p><p>Head. 1.50-1.70 mm wide (including compound eyes). Green, with genal markings and lateral markings, and with irregular markings on frons between scape (sometimes absent). Mandibles asymmetrical, broad; labial and maxillary palpi yellow, brownish on palpomeres 1-2, slightly tapered apically. Antenna shorter than forewing, brownish; scape and pedicel greenish, unmarked, flagellar setae arranged in four rings, flagellum yellowish, setae brownish (Fig. 5B, C, D).</p><p>Thorax. Greenish, pronotum as long as wide; setae dark, with brown, broad stripes present on pronotum laterally, two brown markings present on prescutum of metanotum; transverse sulci present. A yellowish longitudinal median stripe, present on pro-, meso-, and metanotum (Fig. 5A, B, E).</p><p>Legs. Greenish, unmarked, covered with short black setae; claws curved, brown.</p><p>Forewing. 14.60 mm long. Wing membrane transparent, rounded apically, tegula unmarked; longitudinal veins mostly greenish, costal crossveins marked brown or brownish basally, greenish distally, psm-psc crossveins brownish or 1-5 psc-psm crossveins greenish, base of anal veins greenish or marked brown, other veins marked brown. Costal crossveins simple, straight, slightly sinuous on third and fourth crossveins, 22 costal crossveins present; basal subcostal crossvein present, crossveins posteriad pterostigma absent; 13 radial crossveins present; intramedian cell (im) triangular, subdistally connected by 1rp-m crossvein; three gradate series of crossveins present in most individuals but two present occasionally, number of gradates (inner/middle/outer: 7/2/7); basal crossveins of first gradate series not meeting PsM; dcc open, CuP not forked (Fig. 5A, E).</p><p>Hind wing. Pterostigma greenish, veins greenish; 17 costal crossveins present; two gradate series of crossveins, number of gradates (inner/outer): 6/5 (Fig. 5A, E).</p><p>Abdomen. Greenish; red longitudinal stripe present on sterna 2-7, and sterna covered with short black setae; red stripes and markings present on terga; spiracles small, round, not enlarged, atria not enlarged (Fig. 5A, E).</p><p>Male genitalia. Tergum 9 and ectoprocts fused; ectoproct rounded; dorsal invagination shallow; thick setae on ectoproct absent; sterna 8 and 9 fused, regular, without strong apical setae; gonarcus medially fused, lateral arm expanded; entoprocessus robust, slightly curved, bifurcated and slightly expanded; mediuncus closely associated with gonarcus, slender, laterally expanded, mediuncus process absent; gonosaccus robust, with gonosetae and spinellae; parameres absent; numerous gonostae present; gonapsis constituted by a pair of asymmetrical pieces: flat on one side, tapered on the other, slightly curved; tignum absent (Fig. 6A, C, D, E, F).</p><p>Female genitalia. Tergum 9 and ectoprocts fused; sternum 7 simple, apically rounded; subgenitale broader than long, attached to a broad membranous structure; spermatheca round; vela thick and elongate; spermatheca twisted (Fig. 6B, G, H).</p><p>Type material. Holotype ♂, CHINA, Henan: Luoyang, Mt. Baiyunshan (白云山), <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=111.8391&amp;materialsCitation.latitude=33.684" title="Search Plazi for locations around (long 111.8391/lat 33.684)">Xiaohuangshan</a> (小#山), 33.6840°N, 111.8391°E, 1600 m, 11.VII.2020, Weihai Li, Yanhua Yan (CAU) . Paratypes: CHINA, Henan: 3♀, Luoyang, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=111.8436&amp;materialsCitation.latitude=33.6822" title="Search Plazi for locations around (long 111.8436/lat 33.6822)">Mt. Baiyunshan</a> (白云山), 33.6822°N, 111.8436°E, 1500 m, 10.VII.2020, Wenliang Li (CAU); Shaanxi: 2♂, Zhouzhi, Houzhenzi (ñḃŦ), <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=107.7596&amp;materialsCitation.latitude=33.7933" title="Search Plazi for locations around (long 107.7596/lat 33.7933)">Laoxiancheng</a> (Ɩ县µ), 107.7596°E. 33.7933°N, 1777 m, 14.VII.2018 (L), Yingnan He (CAU) ; 2♂, Foping, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=107.7677&amp;materialsCitation.latitude=33.5945" title="Search Plazi for locations around (long 107.7677/lat 33.5945)">Daguping</a> (k古坪), 33.5945°N, 107.7677°E, 1329.2 m, 24.VII.2014 (L), Xiumei Lu (CAU) ; 3♀, Nanzheng, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=106.6509&amp;materialsCitation.latitude=32.8024" title="Search Plazi for locations around (long 106.6509/lat 32.8024)">Liping</a> (NJ坪), 106.6509°E, 32.8024°N, 1554 m, 3.VII.2018 (L), Yingnan He (CAU) ; Sichuan: 1♀, Muli, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=100.7473&amp;materialsCitation.latitude=27.9624" title="Search Plazi for locations around (long 100.7473/lat 27.9624)">Wujiao</a> (屋¶), 27.9624°N, 100.7473°E, 2823 m, 24.VII.2020 (L), Yuezheng Tu (CAU) .</p><p>Etymology. The specific name neptuna is derived from the Latin name Neptunus, the god of sea, using trident as weapon, referring to the trifurcated frontal marking of the new species.</p><p>Distribution. China (Sichuan, Henan, Shaanxi).</p><p>Remarks. Although the specimens of K. neptuna we examined show significant variation, such as the markings on the frons and the coloration of the forewing veins, the new species can be distinguished by its greenish hind wing veins, a smaller gonapsis, and mediuncus noticeably more slender than that of other species of Kuwayamachrysa . Therefore, combining morphological characteristics and molecular evidence (Fig. 7), we propose K. neptuna as a new species with variable characteristics, and we suggest that it is the species that Lai et al. (2024) referred to as Kuwayamachrysa sp. 1 YLBOLD.</p><p>DNA barcode sequence</p><p>TCGCGACAGTGATTATTTTCAACTAACCATAAAGATATTGGTACATTATATTTTATTTTTGGAATTTGATC TCTGGATTAGTAGGTACTAGTTTAAGATTATTAATTCGAGCTGAATTAGGTCTCTGGATTAGTAGGTAAA CCAGGTTCATTAATTGGTGATGATCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTT TTTATAGTTATACCTATTGTAATTGGAGGATTTGGTAATTGATTAGTTCGGAACAGGTTGAACTGTCTAT CACCCCTTTCTTCTAGAATTGCCCATGCAGGAGCTTCTGTTGATTTAGCTATTTTTAGTTTACATTTAGC TGGAATTTCATCAATTTTAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGTTTAAGATACATAA CTTTAGATCGAATACCCTTATTTGTTTGATCAGTTGTTATTACAGCATTACTTCTTCTATTATCTTTACCTG TATTAGCAGGAGCTATCACTATATTATTAACAGATCGTAATTTAAATACTTCTTTTTTTGATCCCGCAGGA GG AGGAGATCCAATTTTATACCAACATTTATTTTGA</p></div>	https://treatment.plazi.org/id/137787C07C7A13711ABFFD08B639FA78	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Wang, Maozhi;Lai, Yan;Liu, Xingyue	Wang, Maozhi, Lai, Yan, Liu, Xingyue (2025): The green lacewing genus Kuwayamachrysa Tsukaguchi & Tago, 2018 from China, with description of two new species based on morphological and molecular evidence. Zootaxa 5570 (1): 138-150, DOI: 10.11646/zootaxa.5570.1.6, URL: https://doi.org/10.11646/zootaxa.5570.1.6
137787C07C7613701ABFFF6FB08BFEE3.text	137787C07C7613701ABFFF6FB08BFEE3.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Kuwayamachrysa Tsukaguchi & Tago 2018	<div><p>Key to species of Kuwayamachrysa</p><p>1. Hind wing costal crossveins brown....................................................................... 2</p><p>- Hind wing costal crossveins mostly pale green (Fig. 5A)....................................... K. neptuna sp. nov.</p><p>2. Terga without red stripes; flat pieces of gonapsis with serrated edge (Fig. 2F)............................. … K. kichijoi</p><p>- Red stripes present on terga; flat pieces of gonapsis with smooth edge (Fig. 4F)................. K. wujiaoensis sp. nov.</p></div>	https://treatment.plazi.org/id/137787C07C7613701ABFFF6FB08BFEE3	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		MagnoliaPress via Plazi	Wang, Maozhi;Lai, Yan;Liu, Xingyue	Wang, Maozhi, Lai, Yan, Liu, Xingyue (2025): The green lacewing genus Kuwayamachrysa Tsukaguchi & Tago, 2018 from China, with description of two new species based on morphological and molecular evidence. Zootaxa 5570 (1): 138-150, DOI: 10.11646/zootaxa.5570.1.6, URL: https://doi.org/10.11646/zootaxa.5570.1.6
