Hepatozoon, Miller, 1908
publication ID |
https://doi.org/10.1016/j.ijppaw.2018.06.003 |
persistent identifier |
https://treatment.plazi.org/id/032F879B-FFE7-2935-AB6B-FE3FD21CEAA9 |
treatment provided by |
Felipe |
scientific name |
Hepatozoon |
status |
|
2.5. Amplification of 18S gene of Hepatozoon View in CoL
The amplification was performed by conventional PCR in an Eppendorf Mastercycler ª Pro thermocycler, using primers HepF300 (GTTTCTGACCTATCAGCTTTCGACG) and Hep900 (CAAATCTAAGAAT TTCACCTCTGAC) ( Ujvari et al., 2004). For the PCR, 4 μL of extracted DNA was used, and the final reaction volume was 25 μL, which contained 0.5 μL of Taq Polymerase (5 U/μL, Bioline), 1 μL of MgCl (50 mM), 2.5 μL of PCR Buffer (10X), 0.5 μL of dNTPs (10 mM) and 1 μL of each primer (10 pmol). The conditions of the amplifications were as follows: an initial denaturation at 94 ̊C for 3 min, followed by 35 cycles at 94 ̊C for 30 s, annealing at 60 ̊C for 30 s, extension at 72 ̊C for 1 min and a final extension at 72 ̊C for 10 min. The products obtained from the amplification of COI, gltA, 16S, ompA and 18S were purified with SureClean Plus (Bioline, USA) following the supplier's instructions. These products were sequenced in both directions.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.