Hepatozoon, Miller, 1908

Cotes-Perdomo, Andrea, Santodomingo, Adriana & Castro, Lyda R., 2018, Hemogregarine and Rickettsial infection in ticks of toads from northeastern Colombia, International Journal for Parasitology: Parasites and Wildlife 7 (2), pp. 237-242 : 240

publication ID

https://doi.org/10.1016/j.ijppaw.2018.06.003

persistent identifier

https://treatment.plazi.org/id/032F879B-FFE7-2935-AB6B-FE3FD21CEAA9

treatment provided by

Felipe

scientific name

Hepatozoon
status

 

2.5. Amplification of 18S gene of Hepatozoon View in CoL

The amplification was performed by conventional PCR in an Eppendorf Mastercycler ª Pro thermocycler, using primers HepF300 (GTTTCTGACCTATCAGCTTTCGACG) and Hep900 (CAAATCTAAGAAT TTCACCTCTGAC) ( Ujvari et al., 2004). For the PCR, 4 μL of extracted DNA was used, and the final reaction volume was 25 μL, which contained 0.5 μL of Taq Polymerase (5 U/μL, Bioline), 1 μL of MgCl (50 mM), 2.5 μL of PCR Buffer (10X), 0.5 μL of dNTPs (10 mM) and 1 μL of each primer (10 pmol). The conditions of the amplifications were as follows: an initial denaturation at 94 ̊C for 3 min, followed by 35 cycles at 94 ̊C for 30 s, annealing at 60 ̊C for 30 s, extension at 72 ̊C for 1 min and a final extension at 72 ̊C for 10 min. The products obtained from the amplification of COI, gltA, 16S, ompA and 18S were purified with SureClean Plus (Bioline, USA) following the supplier's instructions. These products were sequenced in both directions.

Darwin Core Archive (for parent article) View in SIBiLS Plain XML RDF