Rigga isa Grishin, 2023
publication ID |
https://doi.org/10.5281/zenodo.10396362 |
persistent identifier |
https://treatment.plazi.org/id/03810139-FF92-BB1E-C0CA-FA09E291B145 |
treatment provided by |
Felipe |
scientific name |
Rigga isa Grishin |
status |
sp. nov. |
Rigga isa Grishin , new species
https://zoobank.org/ 82DE66CF-AF62-4C68-9D1F-3ABCEBCFD07E
( Fig. 7 part, 187–188, 423–424)
Definition and diagnosis. Phylogenetic trees reveal that specimens from Ecuador similar in appearance to Rigga auristriga (Draudt, 1923) (type locality in Bolivia, holotype sequenced as NVG-18093C02) are not monophyletic with it and show prominent genetic differentiation from it ( Fig. 7): e.g., their COI barcodes differ by 5.5% (36 bp), and therefore represent a new species. This new species is sister to Rigga ira (A. Butler, 1870) (type locality not given, possibly in Venezuela) and differs from it by 3.2% (21 bp) in the COI barcode. The hindwing of the new species is uniformly colored above, lacking yellow rays of R. ira , ventral hindwing veins are overscaled with approximately uniform thickness (except M 2, which is weaker), and there is no appearance of a ray along the radius and vein M 1 as in R. ira . The new species differs from R. auristriga , which frequently has similar uniform overscaling of veins, by wider forewing spots and wider lower section of stigma. This species is not cryptic and is diagnosed reliably by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly2284.14.4:G85C, aly4778.18.1:C946T, aly4778.18.1:T1398C, aly1937.17.47:C39A, aly1019.14.1:A84T, and COI barcode: A100G, C343A, T397C, T463C, T556C.
Barcode sequence of the holotype. Sample NVG-19019G06, GenBank OR837708, 658 base pairs:
AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATATTAGGAACTTCTTTAAGTATACTAATTCGAACAGAATTAGGTAACCCAGGATCTTTAATT GGGGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATT GATTAGTCCCCCTTATACTAGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGAATGCTTCCCCCTTCTTTAACACTTTTAAT TTCTAGAAGAATTGTTGAAAATGGAGCAGGTACTGGTTGAACAGTTTACCCACCTCTTTCTTCTAATATTGCCCACCAAGGTTCTTCTGTTGATTTA GCAATTTTCTCCCTTCATTTAGCAGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAACATACGAGTTAGAAATTTATCAT TTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACAGCATTATTATTACTTTTATCTTTACCTGTCTTAGCAGGAGCTATTACTATACTTCT TACAGATCGAAATTTAAATACTTCTTTTTTTGACCCTGCTGGAGGAGGAGACCCAATTTTATACCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution , Washington, DC, USA ( USNM), illustrated in Fig. 187–188, bears the following five rectangular labels, four white: [ ECUADOR Napo | Baeza 2000m | 6 July ’80 | S. S. Nicolay], [ Parphorus | hesia ♂ | Det. Hew. | S.S. Nicolay], [DNA sample ID: | NVG-19019G06 | c/o Nick V. Grishin], [USNMENT | { QR Code} | 01532617], and one red [ HOLOTYPE ♂ | Rigga isa | Grishin] . Paratype: 1♀ NVG-21047G03 Ecuador: Napo, El Chaco, 1500 m, Nov-1971, R. de Lafebre leg. [ MGCL].
Type locality. Ecuador: Napo Province, Baeza, elevation 2000 m.
Etymology. The name is formed from the Greek ίσος (isos), meaning equal. It reflects the equal overscaling of nearly all veins and signifies a more uniform appearance than R. ira and other congeners. The name is a noun in apposition.
Distribution. Ecuador.
USNM |
Smithsonian Institution, National Museum of Natural History |
V |
Royal British Columbia Museum - Herbarium |
R |
Departamento de Geologia, Universidad de Chile |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |