Wahydra cuzcona Grishin, 2023
publication ID |
https://doi.org/10.5281/zenodo.10396362 |
DOI |
https://doi.org/10.5281/zenodo.10622079 |
persistent identifier |
https://treatment.plazi.org/id/03810139-FFED-BB62-C0CA-FFB3E7B6B784 |
treatment provided by |
Felipe |
scientific name |
Wahydra cuzcona Grishin |
status |
sp. nov. |
Wahydra cuzcona Grishin , new species
https://zoobank.org/ 5C35C09C-FEAE-43D3-A1FD-874FF72F0803
( Fig. 5 part, 111–112, 339–341)
Definition and diagnosis. Phylogenetic trees reveal that a unique-looking specimen of Wahydra Steinhauser, 1991 ( type species Pamphila kenava Butler, 1870 ) from Cuzco, Peru, belongs to the W. kenava group but does not show any clear affinities to a particular species, and therefore is new. This new species is genetically distant from all others; e.g., its COI barcode differs from that of W. kenava ( type locality in Venezuela) by 7.3% (48 bp). This new species is diagnosed by an unique (for Wahydra ) wing pattern: forewing orange spots are narrower, the cell CuA 2 -1A+2A is with one small elongated spot, situated along vein 1A+2A, the spot in cell CuA 1 -CuA 2 is rhomboidal and the spot in cell M 3 -CuA 1 is separated from it by dark vein and shifted distad, overlapping with it by less than half of the width, the spot in cell R 5 -M 1 is the smallest, slightly elongated; hindwing with a cluster of four spots in the subapical area, separated by dark veins: the spot between veins M 1 and M 3 is the largest, about a third of wing’s length, other spots are less than half of this spot in length, those in cells RS-M 1 and M 3 -CuA 1 are aligned to its distal margin (to follow the curvature of the outer wing margin) and the spot in the cell CuA 1 -CuA 2 is aligned to the center of the M 1 -M 3 spot, thus shifted basad from the spot in cell M 3 -CuA 1; ventral side of wings is similar to Wahydra thisbe (Hayward, 1942) ( type locality in Ecuador) in lacking the paler ray anteriad of the dark wing section by inner margin, but the forewing yellow spots are smaller. This species is not cryptic and is diagnosed reliably by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly3176.7.1:A170G, aly770.23.1:A79G, aly770.23.1:A93G, aly276634.3.2:C125A, aly536.138.1:T18C, aly159.13.1:A378A (not G), aly276634.3.2:C140C (not T), aly50.26.1:C33C (not G), aly587.20.1:T1440T (not A), aly499.36.22:G111G (not A), and COI barcode: T38C, T106C, T127C, T259C, T349C, A514C.
Barcode sequence of the holotype. Sample NVG-7989, GenBank OR837674, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGGGCAGGAATACTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATT GGAGATGACCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATT GATTAGTTCCATTAATATTAGGTGCACCTGATATAGCTTTTCCACGAATAAATAATATAAGATTCTGAATATTACCTCCTTCCTTAATACTTCTAAT TTCTAGTAGAGTCGTAGAAAATGGTGCAGGGACTGGTTGAACAGTTTACCCCCCCCTCTCATCTAATATTGCACATCAAGGAGCATCTGTCGATTTA GCAATTTTTTCTCTTCATTTAGCAGGAATTTCCTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATATATCAT TTGATCAAATACCCTTATTTGTATGATCCGTAGGAATTACAGCTTTACTTTTACTTTTATCTTTACCAGTATTAGCTGGAGCTATTACAATACTTTT AACAGATCGAAATTTAAATACATCTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATCCTATATCAACATTTATTT
Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution , Washington, DC, USA ( USNM), illustrated in Fig. 111–112, bears the following five rectangular labels, four white: [ PERU: Cusco | Qda. Morro Leguia | 13°08′ 71°33′ | 29 Aug 1989, 2150m | Leg. R. Robbins], [DNA sample ID: | NVG-7989 | c/o Nick V. Grishin], [genitalia| NVG170207-74 | Nick V. Grishin], [USNMENT | { QR Code} | 01321829], and one red [ HOLOTYPE ♂ | Wahydra | cuzcona Grishin ].
Type locality. Peru: Cuzco Region, Cosñipata Valley, Quebrada Moro Leguia, elevation 2150 m, GPS −13.133, −71.550.
Etymology. The name is given for the type locality and is a noun in apposition.
Distribution. Currently known only from the holotype collected in the Cosñipata Valley, Peru.
USNM |
Smithsonian Institution, National Museum of Natural History |
R |
Departamento de Geologia, Universidad de Chile |
V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.