Cubus johnstiremani Zúñiga, Valerio & Hanson, 2025

Cubus johnstiremani Zúñiga, Valerio & Hanson , sp. nov.

( Figs. 1 View FIGURES 1–2 , 7 View FIGURES 3–8 , 23 View FIGURES 22–26 )

Diagnostic description. Female. Fore wing length 6.8–7.4 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 28–30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark more or less parallel to eye margin; lower 0.6 of pronotum black; ventral mesothorax with at least some black; hind coxa completely yellow, without black marks; propodeum with a longitudinal black line that is narrower than propodeal orifice; tergite I with dark mark restricted to middle, yellow anteriorly.

Male. Unknown.

Comments. Cubus johnstiremani and C. montywoodi are the only species having completely yellow legs, without any dark marks, not even on the hind coxa. Both species are also unique in having at least some black on the ventral mesothorax. However, they are easily distinguished by the form of the black mark on the propodeum ( Table 1 View TABLE 1 ). Cubus johnstiremani and C. normwoodleyi are the only species having a very narrow longitudinal black line on the propodeum. The former differs by the absence of black marks on the hind coxa.

Hosts. This species was found in the San Cristobal, Oro, and Rincon Rain Forest Sectors. It has been reared on 12 occasions from Ategumia lotanalis and Rhectocraspeda periusalis ( Crambidae ) feeding on Conostegia xalapensis ( Melastomataceae ), Piper auritum , P. peltatum , and P. umbellatum ( Piperaceae ).

Etymology. This species is named in honor of John Stireman of Wright State University, in recognition of his contributions to the ACG tachinid fly inventory.

Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0035199 . 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 09-SRNP-2196. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Del Oro, Sendero Puertas , 11.01087, -85.48817, 400m (Elieth Cantillano) caterpillar feeding on Tapirira mexicana ( Anacardiaceae ) coll. 07. vii.2009 wasp eclosed 10.vii.2009 GoogleMaps . Paratypes. 11 ♀, ( EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 01-SRNP-4863: DHJPAR0024414 (♀) ; 02-SRNP-6690: DHJPAR0014082 (♀) ; 04-SRNP-24731: DHJPAR0014028 (♀) ; 04-SRNP-24732: DHJPAR0014037 (♀) ; 04-SRNP-27154: DHJPAR0014052 (♀) ; 09-SRNP-44000: DHJPAR0035169 (♀) ; 09-SRNP-44146: DHJPAR0035165 (♀) ; 09-SRNP-44274: DHJPAR0035158 (♀) ; 09- SRNP-44507: DHJPAR0036003 (♀) ; 09-SRNP-2757: DHJPAR0036009 (♀) ; 10-SRNP-80898: DHJPAR0041087 (♀) .

Barcode. DNA barcode of female holotype DHJPAR0035199 (629 bp): CAGGTACAATTGGAACTTCAACAAGTATAATTATTCGAATTCAACTTATAAATCCAATAACATTAATTATTAATGA TCAAATATATAATTCTTTAGTAACAATACATGCATTCTTAATAATTTTTTTTTTAGTTATACCTACNATAATTGGA GGATTTGGAAATTGATTAATTCCATTAATATTAGGAACTCCTGATATAGCATTTCCACGTATAAATAATATAAGAT TCTGATTATTACCTCCCTCAATAATTATATTATTAATAAGTAGAATTATTAATCAAGGACCAGGTACTGGATGAAC AGTTTACCCACCATTATCATCAAATATTAGACATGAAGGAATATCAGTCGATTATGCTATTTTCTCCCTTCATATT GCAGGATCTTCTTCTATTATAGGTGCAATTAACTTTATTACAACAATTTTTAATTTAAAAATTAAAAATTTAAAAA TAAGACAATTAACACTTTTCTCATGATCAATTATTATTACATCAATTTTACTTCTACTAGCTGTACCCGTTTTAGC TGGTGCCCTAACAATATTAATTTTTGATCGAAACTTAAATACATCATTCTTTGATCCCTCCGGAGGGGGAGACCCA ATTCTATTCCAACATCTCTTC