Cubus jimoharai Zúñiga, Valerio & Hanson, 2025
publication ID |
https://doi.org/10.11646/zootaxa.5590.3.4 |
publication LSID |
lsid:zoobank.org:pub:8F0E3823-08CF-45F0-B7B5-2E2FF662035B |
DOI |
https://doi.org/10.5281/zenodo.14962242 |
persistent identifier |
https://treatment.plazi.org/id/03A3B16B-FFD3-FF88-63E2-0DF5FC754825 |
treatment provided by |
Plazi |
scientific name |
Cubus jimoharai Zúñiga, Valerio & Hanson |
status |
sp. nov. |
Cubus jimoharai Zúñiga, Valerio & Hanson , sp. nov.
( Figs. 11, 13 View FIGURES 11–15 , 22 View FIGURES 22–26 )
Diagnostic description. Female. Fore wing length 7.4–8.4 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 30–33 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark diverging from eye margin; lower 0.3 or 0.4 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on external surface only; propodeum with a somewhat diamond-shaped black mark covering more than half the length of the propodeum, separated from much smaller black mark at posterior end; tergite I with black mark restricted to middle, yellow anteriorly.
Male. Similar to female.
Comments. No other species has a broken black mark on the propodeum, i.e. consisting of two parts. Cubus jimoharai , like C. manuelzumbadoi , has the lateral pronotum predominantly yellow, i.e. the ventral black mark covers less than half the height of the pronotum. However, the hind coxa of the former has a black mark only on the external surface, whereas the latter has a black mark only on the internal surface.
Hosts. This species was found in the San Cristobal, del Oro, Rincon Rain Forest, Santa Rosa, Pocosol, and Pitilla Sectors. It has been reared on 10 occasions from Omiodes humeralis , Phaedropsis Solis 03DHJ01, and Phaedropsis Solis 348 ( Crambidae ) feeding on Inga oerstediana , I. sapindoides , I. vera ( Fabaceae ), Trumfetta lappula ( Malvaceae ), and Triplaris melaenodendron ( Polygonaceae ).
Etymology. This species is named in honor of Jim O'Hara of the Canadian National Collection of Insects, in recognition of his contributions to the ACG tachinid fly inventory.
Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0014068 . 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 03-SRNP-10316. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Rincon Rain Forest, Finca Hugo , 10.88068, -85.26968, 540m (Armando Rios) caterpillar feeding on Inga sapindoides ( Fabaceae ) coll. 10. ii.2003 wasp eclosed 07.v.2003 GoogleMaps . Paratypes. 8 ♀, 1 ♂, ( EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 99-SRNP-11316: DHJPAR0024398 ( ♀) ; 99-SRNP-11319: DHJPAR0024413 ( ♀) ; 04-SRNP-61275: DHJPAR0036920 ( ♂) ; 07-SRNP-24369: DHJPAR0027715 ( ♀) ; 07-SRNP-31220: DHJPAR0017247 ( ♀) ; 07- SRNP-34128: DHJPAR0023325 ( ♀) ; 08-SRNP-5380: DHJPAR0030305 ( ♀) ; 13-SRNP-5069: DHJPAR0053506 ( ♀) ; 99-SRNP-11314: DHJPAR0024404 ( ♀) .
Barcode. DNA barcode of female holotype DHJPAR0014068 (660 bp): ATATTATATTTCATTTTAGGAATTTGATCAGGAACAATTGGAACTTCTACAAGTATAATTATTCGAATCCAACTTA TAAATCCAATAAAACCATTAATTACTAATGATCAAATATATAATTCTTTAGTAACAATACATGCATTTTTAATAAT TTTTTTTTTAGTTATACCTACAATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAACACCTGAT ATAGCATTCCCACGAATAAATAATATAAGATTTTGACTTTTACCGCCTTCAATAATTCTATTATTAATAAGTAGAA TTATCAATCAAGGCCCAGGTACTGGATGAACAGTATATCCACCTTTATCATCTAATATTAGTCATGAAGGAATATC AGTTGATTATGCTATTTTCTCACTTCATATTGCAGGATCTTCCTCAATTATAGGAGCAATTAATTTTATTACAACA ATTTTTAATTTAAAAATTAAAAACTTAAAAATAAGCAATTAACCCTTTTTTCATGATCAATTATTATCACATCAAT TTTACTTCTTTTAGCTGTTCCTGTATTAGCAGGTGCTTTAACAATATTAATTTTTGATCGAAATTTAAATACTTCA TTCTTTGATCCTTCAGGAGGAGGAGATCCAATTCTTTTTCAACATTTATTT
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |