Cubus gracewoodae Zúñiga, Valerio & Hanson, 2025

Cubus gracewoodae Zúñiga, Valerio & Hanson , sp. nov.

( Figs. 4 View FIGURES 3–8 , 15 View FIGURES 11–15 , 20 View FIGURES 16–21 )

Diagnostic description. Female. Fore wing length 6.8–7.6 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 29–30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark diverging from eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with a longitudinal black mark that is chalice-shaped (narrower near the middle); tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally.

Male. Similar to female.

Comments. Cubus gracewoodae is one of three species that has the dorsal margin of black mark on the occiput diverging from eye margin ( Table 1 View TABLE 1 ). It can be distinguished from these other two species by the size of the black mark on the lateral pronotum and the form of the black mark on the propodeum.

Hosts. This species was found in the San Cristobal, Oro, and Brasilia Sectors. It has been reared on 23 occasions from Pantographa suffusalis and Pantographa Solis 116 ( Crambidae ) feeding on Allosidastrum pyramidatum , Hampea appendiculata , Wissadula excelsior ( Malvaceae ).

Etymology. This species is named in honor of Grace Wood of the Canadian National Collection of Insects, in recognition of her contributions to the ACG tachinid fly inventory.

Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0014030 . 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 04-SRNP-24207. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Del Oro, Quebrada Raiz , 11.02865, -85.48669, 280m. (Lucia Rios) caterpillar feeding on Allosidastrum pyramidatum ( Malvaceae ) coll.21.xiii.2004 wasp eclosed 16.xi.2004 GoogleMaps . Paratypes. 20 ♀, 2 ♂, ( EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 04-SRNP-24259: DHJPAR0014026 (♀) ; 04-SRNP-24261: DHJPAR0014027 (♂) ; 04-SRNP-24792: DHJPAR0014034 (♀) ; 04-SRNP-26119: DHJPAR0014053 (♀) ; 04-SRNP-26120: DHJPAR0014031 (♀) ; 04-SRNP-26125: DHJPAR0014033 (♀) ; 04-SRNP-26132: DHJPAR0014049 (♀) ; 04-SRNP-26135: DHJPAR0014042 (♀) ; 04-SRNP-26387: DHJPAR0014046 (♀) ; 04-SRNP-26394: DHJPAR0014047 (♀) ; 04- SRNP-26471: DHJPAR0014038 (♀) ; 04-SRNP-26540: DHJPAR0014051 (♀) ; 04-SRNP-26541: DHJPAR0014041 (♀) ; 04-SRNP-26547: DHJPAR0014054 (♀) ; 04-SRNP-26549: DHJPAR0014050 (♀) ; 04-SRNP-26550: DHJPAR0014048 (♀) ; 04-SRNP-26552: DHJPAR0014055 (♀) ; 05-SRNP-7853: DHJPAR0009753 (♀) ; 09-SRNP-23374: DHJPAR0038419 (♂) ; 05-SRNP-33461: DHJPAR0028562 (♀) ; 07-SRNP-65964: DHJPAR0023305 (♀) ; 13-SRNP-540: DHJPAR0051744 (♀) .

Barcode. DNA barcode of female holotype DHJPAR0014030 (660 bp): ATATTATATTTTATTTTAGGAATCTGATCAGGTACAATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTTA TAAATCCAATAAAACCATTAATTATTAATGATCAAATATATAATTCTTTAGTAACAATACATGCATTCTTAATAAT TTTTTTTTTAGTTATACCTACAATAATTGGAGGTTTCGGAAATTGATTAATTCCATTAATACTAGGAACTCCTGAT ATAGCATTCCCTCGAATAAATAATATAAGATTCTGACTTTTACCCCCCTCAATAATCATATTATTAATAAGAAGAA TTATTAATCAAGGACCAGGTACTGGGTGAACTATTTACCCCCCATTATCATCAAATATTAGACATGAAGGAATATC AGTTGATTATGCTATTTTCTCCCTACATATTGCGGGATCCTCATCTATTATAGGAGCAATTAATTTTATCACAACA ATTTTTAATTTAAAAATTAAAAATTTAAAAATAAGACAATTAACTCTTTTCTCATGATCAATTATTATTACATCAA TTTTACTTCTTTTAGCTGTTCCTGTTTTAGCTGGTGCTCTAACAATATTAATTTTTGATCGAAATTTAAATACATC ATTCTTTGACCCCTCAGGAGGGGGAGACCCAATTCTTTTCCAACATCTATTC