Cubus curtsabrowskyi Zúñiga, Valerio & Hanson, 2025

Cubus curtsabrowskyi Zúñiga, Valerio & Hanson , sp. nov.

( Figs. 6 View FIGURES 3–8 , 12 View FIGURES 11–15 , 18 View FIGURES 16–21 )

Diagnostic description. Female. Fore wing length 8.5–9.4mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 28–29 flagellomeres. Posterior projections of ventral mesothorax conical and blunt. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark diverging from eye margin; lateral pronotum, in addition to black mark on lower 0.6, with a black lobe extending anteriorly from middle of posterior margin; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with a chalice-shaped or triangular black mark that is widest anteriorly, narrowing posteriorly, then widening slightly at posterior margin; tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally.

Male. Similar to female.

Comments. Cubus curtsabrowskyi and C. manuelzumadoi are the only two species having the posterior mesosternal projections stout and cone-like, as opposed to flat and more sharply pointed at the apex. The former can be readily distinguished by having a larger black mark on the occiput and by having a black mark on both surfaces of the hind coxa, as opposed to just the internal surface in C. manuelzumadoi .

Hosts. This species was found in Rincon Rain Forest, Mundo Nuevo, and Santa Rosa Sectors. It has been reared on 69 occasions from Omiodes cuniculalis ( Crambidae ) feeding on Gliricidia sepium and Platymiscium parviflorum ( Fabaceae ).

Etymology. This species is named in honor of Curt Sabrowsky of the U.S. National Museum of Natural History, in recognition of his contributions to the ACG tachinid fly inventory.

Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0009953 . 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 05-SRNP-66072. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Mundo Nuevo, Punta Plancha , 10.74160, -85.42734, 420m (Mariano Pereira) caterpillar feeding on Gliricidia sepium ( Fabaceae ) coll. 25.xi.2005 wasp eclosed 28.xii.2005 GoogleMaps . Paratypes. 67 ♀, 1 ♂, ( EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 00-SRNP-14512: DHJPAR0014075 (♀) ; 00-SRNP-14513: DHJPAR0014083 (♀) ; 00-SRNP-14527: DHJPAR0014085 (♀) ; 00-SRNP-14534: DHJPAR0014076 (♀) ; 00-SRNP-14547: DHJPAR0014072 (♀) ; 05-SRNP-66036: DHJPAR0009947 (♀) ; 05-SRNP-66037: DHJPAR0009735 (♀) ; 05-SRNP-66038: DHJPAR0009950 (♀) ; 05-SRNP-66039: DHJPAR0009949 (♀) ; 05-SRNP-66040: DHJPAR0009739 (♀) ; 05- SRNP-66042: DHJPAR0009946 (♀) ; 05-SRNP-66043: DHJPAR0024421 (♀) ; 05-SRNP-66045: DHJPAR0009734 (♀) ; 05-SRNP-66047: DHJPAR0024423 (♀) ; 05-SRNP-66048: DHJPAR0024419 (♀) ; 05-SRNP-66050: DHJPAR0024420 (♀) ; 05-SRNP-66051: DHJPAR0009954 (♀) ; 05-SRNP-66052: DHJPAR0009733 (♀) ; 05- SRNP-66055: DHJPAR0009948 (♀) ; 05-SRNP-66056: DHJPAR0009738 (♀) ; 05-SRNP-66058: DHJPAR0009740 (♀) ; 05-SRNP-66059: DHJPAR0009737 (♀) ; 05-SRNP-66060: DHJPAR0009952 (♀) ; 05-SRNP-66061: DHJPAR0009732 (♀) ; 05-SRNP-66063: DHJPAR0024422 (♀) ; 05-SRNP-66070: DHJPAR0009736 (♀) ; 05- SRNP-66071: DHJPAR0009951 (♀) ; 05-SRNP-66072: DHJPAR0009953 (♀) ; 05-SRNP-66074: DHJPAR0009731 (♀) ; 05-SRNP-66141: DHJPAR0009730 (♀) ; 08-SRNP-15743: DHJPAR0028345 (♂) ; 08-SRNP-15744: DHJPAR0028363 (♀) ; 08-SRNP-15745: DHJPAR0028342 (♀) ; 08-SRNP-15755: DHJPAR0028350 (♀) ; 08- SRNP-15756: DHJPAR0028357 (♀) ; 08-SRNP-15760: DHJPAR0028368 (♀) ; 08-SRNP-15761: DHJPAR0028370 (♀) ; 08-SRNP-15762: DHJPAR0028361 (♀) ; 08-SRNP-15764: DHJPAR0028371 (♀) ; 08-SRNP-15767: DHJPAR0028348 (♀) ; 08-SRNP-15773: DHJPAR0028372 (♀) ; 08-SRNP-15779: DHJPAR0028362 (♀) ; 08- SRNP-15782: DHJPAR0028358 (♀) ; 08-SRNP-15786: DHJPAR0028365 (♀) ; 08-SRNP-15788: DHJPAR0028347 (♀) ; 08-SRNP-15791: DHJPAR0028353 (♀) ; 08-SRNP-15794: DHJPAR0028346 (♀) ; 08-SRNP-15803: DHJPAR0028344 (♀) ; 08-SRNP-15805: DHJPAR0028369 (♀) ; 08-SRNP-15807: DHJPAR0028349 (♀) ; 08- SRNP-15809: DHJPAR0028366 (♀) ; 08-SRNP-15810: DHJPAR0028351 (♀) ; 08-SRNP-15812: DHJPAR0028367 (♀) ; 08-SRNP-15813: DHJPAR0028356 (♀) ; 08-SRNP-15820: DHJPAR0028354 (♀) ; 08-SRNP-15826: DHJPAR0028364 (♀) ; 08-SRNP-15786: DHJPAR0028360 (♀) 09-SRNP-14797: DHJPAR0035995 (♀) ; 09- SRNP-14801: DHJPAR0036243 (♀) ; 09-SRNP-14802: DHJPAR0035994 (♀) ; 09-SRNP-14818: DHJPAR0036043 (♀) ; 09-SRNP-14824: DHJPAR0036247 (♀) ; 09-SRNP-14844: DHJPAR0036292 (♀) ; 09-SRNP-14851: DHJPAR0036288 (♀) ; 09-SRNP-14912: DHJPAR0039123 (♀) ; 09-SRNP-14904: DHJPAR0039124 (♀) ; 09- SRNP-14903: DHJPAR0039128 (♀) ; 12-SRNP-12607: DHJPAR0050847 (♀) ; 12-SRNP-12594: DHJPAR0050808 (♀) ; 12-SRNP-12607: DHJPAR0050847 (♀) .

Barcode. DNA barcode of female holotype DHJPAR0009953 (532 bp): TTAATGATCAAACATATAATTCTTTAGTAACAATACATGCATTTTTAATAATTTTTTTTTTAGTTATACCTACAAT AATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAACACCTGATATAGCATTTCCTCGAATAAATAAT ATAAGATTTTGACTTTTACCTCCTTCAATAATTTTACTATTTATAAGTAGAATTATTAATCAAGGTCCAGGTACTG GATGAACAATATATCCACCATTATCATCTAATATTAGTCATGAAGGAATATCAGTTGATTATGCTATTTTCTCTCT TCATATTGCAGGATCTTCTTCAATTATGGGAGCAATTAATTTTATTACAACAATTTTTAATTTAAAAATTAAAAAT TTAAAAATAAGACAATTAACCCTTTTCTCATGATCAATTATAATTACATCAATTTTACTTCTTTTAGCTGTTCCTG TTCTAGCAGGAGCACTAACAATATTAATTTTTGATCGAAATTTAAATACATCATTTTTTGATCCATCAGGTGGAGG