Cubus christhompsoni Zúñiga, Valerio & Hanson, 2025
publication ID |
https://doi.org/10.11646/zootaxa.5590.3.4 |
publication LSID |
lsid:zoobank.org:pub:8F0E3823-08CF-45F0-B7B5-2E2FF662035B |
DOI |
https://doi.org/10.5281/zenodo.14962231 |
persistent identifier |
https://treatment.plazi.org/id/03A3B16B-FFD9-FF82-63E2-0BE4FDE84BD4 |
treatment provided by |
Plazi |
scientific name |
Cubus christhompsoni Zúñiga, Valerio & Hanson |
status |
sp. nov. |
Cubus christhompsoni Zúñiga, Valerio & Hanson , sp. nov.
( Fig. 17 View FIGURES 16–21 )
Diagnostic description. Female. Fore wing length 6.9–8.3 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 28–30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark more or less parallel to eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with a longitudinal black line that is about as wide as propodeal orifice; tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally.
Male. Similar to female.
Comments. Cubus christhompsoni is quite similar to Cubus alanflemingi but the black line on tergite I becomes very wide in the middle of the tergite. It is also similar to C. gracewoodae , from which it can be distinguished by genitalic characters and by the form of the black mark on the occiput.
Hosts. This species was found in the San Cristobal, Cacao, Rincon Rain Forest, and Brasilia Sectors. It has been reared on nine occasions from Pantographa suffusalis , Pantographa Solis 116, spiloBioLep01 BioLep243 ( Crambidae ) feeding on Hampea appendiculata , Triumfetta bogotensis , Wissadula excelsior ( Malvaceae ), and Lycianthes synanthera ( Solanaceae )
Etymology. This species is named in honor of the late Chris Thompson, formerly of the U.S. National Museum of Natural History, in recognition of his contributions to the ACG tachinid fly inventory.
Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0009782 . 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 05-SRNP-7719. Database information: Costa Rica, ACG, Guanacaste Prov., Sector San Cristobal, Sendero Pinyal , 10.87161 -85.39333, 2630m ( Anabelle Cordoba) caterpillar feeding on Hampea appendiculata ( Malvaceae ) coll. 07.xii.2005 wasp eclosed 05.i.2006 GoogleMaps . Paratypes. 5 ♀, 1 ♂, ( MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 05-SRPN-7717: DHJPAR00099752 ( ♀) ; 05-SRPN-7720: DHJPAR0009746 ( ♀) ; 07-SRPN-65970: DHJPAR0023356 ( ♀) ; 05-SRPN-65967: DHJPAR0023304 ( ♀) ; 04-SRPN-48231: DHJPAR0014060 ( ♀) ; 09- SRPN-3153: DHJPAR0036008 ( ♀) ; 04-SRPN-48228: DHJPAR0014059 ( ♀) ; 07-SRPN-65963: DHJPAR0023355 ( ♂) .
Barcode. DNA barcode of female holotype DHJPAR0009782 (560 bp): TTAATGATCAAATATATAATTCTTTAGTTACAATACATGCATTCTTGATAATTTTTTTTTTAGTTATACCTACAAT AATTGGAGGTTTCGGAAATTGATTAATTCCATTAATATTAGGAACTCCTGATATAGCATTCCCTCGAATAAATAAT ATAAGATTCTGACTTTTACCTCCCTCAATAATTATATTATTAATAAGAAGAATTATTAATCAAGGACCAGGCACTG GGTGAACTGTTTACCCCCCATTATCATCAAATATTAGACATGAAGGTATATCAGTTGATTACGCTATTTTCTCCTT ACATATTGCGGGATCCTCATCTATTATAGGAGCAATTAATTTTATCACAACAATTTTTAATTTAAAAATTAAAAAT TTAAAAATAAGGCAATTAACTCTTTTCTCATGATCAATTATTATTACATCAATTTTACTTCTTTTAGCCGTACCTG TTTTAGCTGGCGCTCTAACAATATTAATTTTTGATCGAAATTTAAATACATCATTCTTTGATCCTTCAGGGGGAGG AGACCCAATTCTTTTCCAACATCTATTC
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |