Cubus alanflemingi Zúñiga, Valerio & Hanson, 2025
publication ID |
https://doi.org/10.11646/zootaxa.5590.3.4 |
publication LSID |
lsid:zoobank.org:pub:8F0E3823-08CF-45F0-B7B5-2E2FF662035B |
DOI |
https://doi.org/10.5281/zenodo.14962229 |
persistent identifier |
https://treatment.plazi.org/id/03A3B16B-FFDA-FF83-63E2-0DF7FE404D40 |
treatment provided by |
Plazi |
scientific name |
Cubus alanflemingi Zúñiga, Valerio & Hanson |
status |
sp. nov. |
Cubus alanflemingi Zúñiga, Valerio & Hanson , sp. nov.
( Fig. 16 View FIGURES 16–21 )
Diagnostic description. Female. Fore wing length 7.4–8.1 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 29–30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark more or less parallel to eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with longitudinal black line that is about as wide as propodeal orifice; tergite I with median black line reaching middle of tergite, sometimes vestigial anteriorly.
Male. Similar to female.
Comments. Both C. alanflemingi and C. christhompsoni have a relatively broad longitudinal black line in the center of the propodeum, but the former can be distinguished by tergite I having a simple black line that is usually not expanded laterally.
Hosts. This species was found in the Pocosol, Santa Rosa, Rincon Rain Forest, Del Oro, Pitilla, and Mundo Nuevo Sectors. It has been reared on 76 occasions from Ategumia lotanalis , Patania Solis 01, and Patania Solis 04 ( Crambidae ) feeding on Cecropia obtusifolia , C. peltata , Pourouma bicolor ( Urticaceae ), Conostegia xalapensis , Graffenrieda galeottii , and Miconia argentea ( Melastomataceae ).
Etymology. This species is named in honor of Al Fleming of the Canadian National Collection of Insects, in recognition of his contributions to the ACG tachinid fly inventory
Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0014080 . 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 00- SRNP-18639. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Santa Rosa, Aréa Administrativa , 10.83764, -85.61871, 295m ( Ruth Franco) caterpillar feeding on Cecropia peltata ( Urticaceae ) coll. 01.x.2000 wasp eclosed 27.x.2000 GoogleMaps . Paratypes. 70 ♀, 5 ♂, ( EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 94-SRNP-6318.1: DHJPAR0024416 ( ♀) ; 94-SRNP-6318.5: DHJPAR0024415 ( ♀) ; 94-SRNP-6318.6: DHJPAR0024417 ( ♀) ; 00-SRNP-18629: DHJPAR0014088 ( ♀) ; 00-SRNP-18632: DHJPAR0014077 ( ♀) ; 00-SRNP-18640 DHJPAR0014078 ( ♂) ; 00-SRNP-18646: DHJPAR0014073 ( ♀) ; 00-SRNP-18651: DHJPAR0014090 ( ♀) ; 00- SRNP-18762: DHJPAR0014084 ( ♀) ; 00-SRNP-18763; DHJPAR0014074 ( ♀) ; 00-SRNP-14017: DHJPAR0024412 ( ♀) ; 00-SRNP-14133; DHJPAR0014086 ( ♂) ; 00-SRNP-14261: DHJPAR0024411 ( ♀) ; 00-SRNP-14909: DHJPAR0014079 ( ♀) ; 00-SRNP-14912: DHJPAR0024410 ( ♀) ; 01-SRNP-5548: DHJPAR0014091 ( ♀) ; 01-SRNP-23296: DHJPAR0014071 ( ♀) ; 02-SRNP-6116: DHJPAR0024408 ( ♀) ; 02-SRNP-6386: DHJPAR0014066 ( ♀) ; 02- SRNP-6387: DHJPAR0014081 ( ♀) ; 02-SRNP-6411: DHJPAR0014067 ( ♀) ; 02-SRNP-6418: DHJPAR0014065 ( ♀) ; 02-SRNP-6702.06: DHJPAR0014063 ( ♀) ; 02-SRNP-6116: DHJPAR0014064 ( ♀) ; 03-SRNP-10611, 03-SRNP-11302: DHJPAR0024409 ( ♀) ; 03-SRNP-11303: DHJPAR0014087 ( ♀) ; 03-SRNP-11322: DHJPAR0014070 ( ♀) ; 04- SRNP-23953: DHJPAR0014057 ( ♀) ; 04-SRNP-23959: DHJPAR0014058 ( ♀) ; 04-SRNP-24690: DHJPAR0014032 ( ♀) ; 04-SRNP-24695: DHJPAR0014062 ( ♀) ; 04-SRNP-24874: DHJPAR0014035 ( ♀) ; 04-SRNP-24879: DHJPAR0014029 ( ♀) ; 04-SRNP-34602: DHJPAR0014043 ( ♀) ; 04-SRNP-34606: DHJPAR0014056 ( ♀) ; 04- SRNP-34611: DHJPAR0014044 ( ♀) ; 04-SRNP-34612: DHJPAR0014045 ( ♀) ; 04-SRNP-41949: DHJPAR0014039 ( ♀) ; 04-SRNP-42119: DHJPAR0014039 ( ♂) ; 04-SRNP-42323: DHJPAR0014040 ( ♀) ; 04-SRNP-42326: DHJPAR0014061 ( ♀) ; 05-SRNP-1474: DHJPAR0036921 ( ♀) ; 05-SRNP-7700: DHJPAR0009781 ( ♀) ; 05-SRNP-33873: DHJPAR0009714 ( ♀) ; 05-SRNP-33875: DHJPAR0009719 ( ♀) ; 05-SRNP-33877: DHJPAR0009716 ( ♀) ; 05- SRNP-33888: DHJPAR0009712 ( ♀) ; 05-SRNP-33901: DHJPAR0036919 ( ♀) ; 05-SRNP-33906: DHJPAR0009715 ( ♀) ; 05-SRNP-34006: DHJPAR0009718 ( ♀) ; 05-SRNP-34022: DHJPAR0009717 ( ♀) ; 05-SRNP-34025: DHJPAR0009711 ( ♀) ; 05-SRNP-34033: DHJPAR0009710 ( ♀) ; 05-SRNP-34040: DHJPAR0009829 ( ♀) ; 06- SRNP-1232: DHJPAR0009625 ( ♀) ; 06-SRNP-40288: DHJPAR0009635 ( ♀) ; 06-SRNP-40290: DHJPAR0009634 ( ♂) ; 06-SRNP-40295: DHJPAR00009637 ( ♀) ; 06-SRNP-41421: DHJPAR0010095 ( ♀) ; 06-SRNP-41424: DHJPAR0010100 ( ♀) ; 09-SRNP-69255: DHJPAR00035993 ( ♀) ; 11-SRNP-81743: DHJPAR0046771 ( ♀) : 12- SRNP-68608: DHJPAR0050883 ( ♀) ; 12-SRNP-68600: DHJPAR0050885 ( ♀) ; 12-SRNP-68622: DHJPAR0050884 ( ♀) ; 12-SRNP-68593: DHJPAR0050906 ( ♀) ; 13-SRNP-69943: DHJPAR0052803 ( ♀) ; 12-SRNP-68618: DHJPAR0050907 ( ♂) ; 13-SRNP-43233: DHJPAR0053531 ( ♀) ; 13-SRNP-77699: DHJPAR0053543 ( ♀) ; 13- SRNP-69942: DHJPAR0052756 ( ♀) ; 13-SRNP-69937: DHJPAR0052800 ( ♀) ; 13-SRNP-69938: DHJPAR0052802 ( ♀) ; 13-SRNP-69949: DHJPAR0052733 ( ♀) ; 13-SRNP-69943: DHJPAR0052803 ( ♀) .
Barcode. Holotype DHJPAR0014080 (626 bp): CAATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTTATAAATCCAATAAAACCATTAATTATTAATGATCA AATATATAATTCTTTAGTAACAATACATGCATTCTTAATAATTTTTTTTTTAGTTATACCTACAATAATTGGAGGA TTTGGAAATTGATTAATTCCATTAATATTAGGAACTCCTGATATAGCATTTCCACGTATAAATAATATAAGATTCT GACTGCTACCCCCCTCAATAATTATATTATTAATAAGTAGAATTATTAATCAAGGACCAGGTACTGGATGAACAAT TTACCCGCCATTATCATCAAATATTAGACATGAAGGAATATCAGTCGATTACGCTATTTTCTCCCTTCATATTGCA GGATCTTCTTCTATTATAGGTGCAATTAACTTTATTACAACTATTTTTAATTTAAAAATTAAAAATTTAAAAATAA GACAATTAACACTTTTCTCATGATCAATTATTATTACATCAATTTTACTCCTATTAGCTGTACCTGTTTTAGCAGG AGCTCTAACAATATTAATTTTTGATCGAAACTTAAATACATCATTCTTTGATCCTTCCGGAGGAGGAGATCCAATT CTCTTCCAACATCTCTTC
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |