Hoplias malabaricus (Bloch, 1794)
publication ID |
https://doi.org/10.26028/cybium/2016-403-002 |
persistent identifier |
https://treatment.plazi.org/id/03AD87BB-0B44-B37A-A871-E166FF48F8CD |
treatment provided by |
Felipe |
scientific name |
Hoplias malabaricus |
status |
|
Hoplias malabaricus View in CoL – Pereira et al., 2013
Holotype. – Argentine: Misiones. Stream tributary of the Acaraguá River ( 27°27’44.63”S; 54°57’5.58”W), Uruguay River Basin. Villa Bonita , Municipio de Campo Ramón, Oberá: UNMDP 574 , 1 ex., 164 mm SL, Rosso, Mabragaña, Avigliano and Schenone coll., 07 Feb. 2011. GoogleMaps
Paratypes. – Argentine: Misiones. Stream tributary of the Acaraguá River , Uruguay River Basin ( 27°27’44.63”S; 54°57’5.58”W) GoogleMaps : UNMDP 3320 , 1 ex. , 174 mm SL; UNMDP
3391, 1 ex., 149 mm SL; UNMDP 3392 , 1 ex., 104 mm SL, Rosso, Avigliano and Schenone coll., 10 Feb. 2014.
Formosa. Paraguay River , Laguna Oca : UNMDP 1950 , 1 ex., 49 mm SL ; UNMDP 1951 , 1 ex., 50 mm SL, Rosso , Mabragaña, Avigliano and Schenone coll., 12 Apr. 2012 ; UNMDP 1868 , 1 ex., 40 mm SL, Rosso , Mabragaña, Avigliano and Schenone coll., 09 Apr. 2012 ; Riacho Sala- dillo : UNMDP 3321 , 1 ex., 142 mm SL ; UNMDP 3322 , 1 ex., 148 mm SL, Rosso , Mabragaña, del Rosso, Avigliano and Schenone coll., 08 Feb. 2014 ; Riacho Salado: UNMDP 3327 , 1 ex., 171 mm SL ; UNMDP 3328 , 1 ex., 146 mm SL ; UNMDP 3329 , 1 ex., 134 mm SL, Rosso , Mabragaña, del Rosso, Avigliano and Schenone coll., 09 Feb. 2014 ; Riacho Mbiguá: UNMDP 3371 , 1 ex., 154 mm SL ; UNMDP 3376 , 1 ex., 165 mm SL, Rosso , Mabragaña, del Rosso, Avigliano and Schenone coll., 08 Feb. 2014 .
Chaco. Small interior lake in an island of Paraná River : UNMDP 1983 , 1 ex., 75 mm SL, Rosso, Mabragaña, Avigliano and Schenone coll., 07 Apr. 2012 .
Brazil: Sao Paulo. Lagoa Marginal , Paraná River : LBV 32184-32186, 3 ex., 77-155 mm SL, L.H.G. Pereira, F.F. Roxo, J.M. Henriques, R . Devidé and V. Paes, coll., 03 Jul. 2008 .
Diagnosis
The Y-shaped configuration of the medial margin of dentaries easily separates Hoplias misionera n. sp. from all the remainder species of Hoplias (parallel-shaped in both Hoplias lacerdae group and Hoplias aimara and V-shaped in Hoplias malabaricus group; Fig. 2 View Figure 2 ).
Hoplias misionera n. sp. can also be distinguished from species in the Hoplias malabaricus group by additional characters other than medial margin of dentaries. The high- er number of total dorsal (14-16 vs 14) and pectoral (12-14 vs 11) fin rays and the number of scales in lateral line (40- 43 vs 38-39) distinguishes Hoplias misionera n. sp. from Hoplias malabaricus . Hoplias misionera n. sp. differs from H. microlepis in unbranched (2-4 vs 2) dorsal-fin rays, the number of scales along lateral line (40-43 vs 43-47) and by a lower number of scales around the caudal peduncle (20 vs 22-24, usually 24). Hoplias misionera n. sp. differs from H. teres by number of scales in lateral line (40-43 vs 38), number of total dorsal-fin rays (14-16 vs 13) and (2-4 vs 3) unbranched dorsal-fin rays and pectoral-fin rays (12- 14 vs 13-15), total vertebrae count (39-40 vs 42), larger dorsal-fin base (16.7-20.9 vs 16.2-17.6% SL) and body depth (20.6-25.4 vs 17-20.6% SL). Hoplias misionera n. Table I. – Morphometric data of Hoplias misionera n. sp. Standard length in mm; values Description
1-14 are percentages of the standard length and values 15-22 are percentages of head Morphometric data are summarized length. SD = standard deviation.
in table I. Body subcylindrical. Greatest body depth at the vertical through the origin of dorsal fin. Anterior profile of head angular in lateral view. Dorsal profile of head markedly straight, only slightly convex in small specimens. Dorsal margin of orbit slightly reaching dorsal profile of head but much closer in small specimens. Dorsal profile of body slightly convex from postoccipital region to dorsal-fin origin; then posteroventrally inclined along the entire dorsal-fin base and finally almost straight but slightly inclined until the origin of dorsalmost procurrent caudal-fin ray. Ventral profile of body slightly convex to pelvic-fin origin, then almost straight from the latter point to anal-fin origin and finally marked concave to origin of ventralmost procurrent caudal-fin ray. Medial margins of contralateral dentaries converging to midline and then running parallel in a characteristic Y-shaped ( Fig. 2 View Figure 2 ). Exten- sion of the parallel section as well as the degree of closeness of margins may vary slightly Upper jaw slightly shorter than lower jaw. Distal portion of maxilla straight. Upper and lower lips slightly sp. can be distinguished from the recently described Hop- fleshy with short skin projections cover- lias mbigua by a distinctly shorter snout length (20.4-24.7 ing externally the entire length of larger caniniform teeth. vs 25.2-28.6% (12.5-16.2
Nostrils situated along horizontal through ventral half of the
HL) and lower pre-nasal distance orbit. Only anterior nostril tubular with a fleshy skin cover- vs 15.2-18.4% HL). Hoplias misionera further differs from
ing its whole opening. Posterior nostril equidistant to the Hoplias mbigua by dorsal profile of head markedly straight
anterior nostril and the anterior margin of orbit. Infraorbitals vs dorsal profile of head markedly concave ( Fig. 3 View Figure 3 ); lower
3 and 4 excluded from the orbital margin. Teeth caniniform jaw with either brown bands, dots or blotches vs always five
in both jaws. A single premaxillary tooth row. First two pre- distinctive transversally brown bands; infraorbital 5 lacking
maxillary teeth large and caniniform, then four-five very pores in laterosensory canal vs infraorbital 5 with one pore,
small teeth followed by other two large canines. Extreme last vertical series of scales on caudal peduncle forming a
canines in this series the largest. Then, one-two small teeth marked curve vs forming a relatively straight line ( Fig. 3 View Figure 3 ); almost in contact with extremely small first maxillary tooth. total vertebrae count 39-40 vs 42; first epibranchial with Maxilla with 30-49 teeth, first five increasing progressively 10-11 vs 12-14 gill rakers. Finally, color pattern also con- in size. Dentary external series composed of three to five tributes to the discrimination between H. misionera and small teeth followed by two larger canines, then other series H. mbigua . H. misionera presents a paler background col- of four-six small teeth and finally ten-sixteeen teeth arranged our and at least 8 lateral posterior-oriented chevron blotches, in a repetitive series of one large and one-two small conic irregularly spaced with decreasing separation between them teeth. Internal series of dentary beginning immediately posas blotches proceed backwards. In H. mbigua flanks display terior or slightly anterior to last conical tooth of external row a conspicuous dark longitudinal band along perforated line and formed of approximately 15 very small teeth. Accessory scales, covering approximately half of the series immediate- ectopterygoids and ectopterygoids with small conical teeth ly above and below lateral line; also, most specimens with a along their ventrolateral margins and several much smaller light band below dark band ( Fig. 3 View Figure 3 ). viliform teeth over their ventromedial surfaces. Accessory ectopterygoids not fragmented, anteriorsly expanded and bearing 12-15 conical teeth along their ventrolateral margins. Total dorsal-fin rays 14-16 (ii-12 n = 2; iii-11 n = 1; ii-13 n = 5, iii-12 n = 8, iii-13 n = 1; iv-12 n = 1). Dorsal fin located well anteriorly to midbody, its origin one scale anterior to the vertical through the pelvic fin origin. Tip of long- est rays of depressed dorsal fin extending (two lateral lines scales length) beyond vertical through anal-fin origin. Total anal-fin rays 10 (ii-8 n = 18). Total pectoral-fin rays 12-14 (i-11 n = 5, i-12 n = 5, i-13 n = 8). Tip of pectoral fin separated from pelvic-fin origin by only two scales. Total pelvic-fin rays 8 (i-7 n = 18). Tip of pelvic fin separated from vertical through anus by only two scales. Total caudal-fin rays 17-18 (i-15-i n = 17, i-16-i n = 1). Predorsal scales (15-16; only one with 18) in an irregular series, decreasing in sizes backwards. Last vertical series of scales on caudal peduncle forming a marked curve. Lateral line complete with 40-43 perforated scales. Perforated scales with a single tubular-like canal not covering total scale length. Longitudinal series of scales between dorsal fin origin and lateral line 5-6; between lateral line and pelvic fin origin 4-5.5. Longitudinal series of scales around caudal peduncle, invariable 20. First epibranchial with 10-11 plate-like denticulated gill rakers. One laminar gill raker on cartilage. First ceratobranchial with five-six more elongated rakers and 12-15 plate-like denticulated gill rakers. Laterosensory canal along ventral surface of dentary with four pores; one specimen (UNMDP 3392) with four pores on the left margin and five on the right margin. A single laterosensory canal along infraorbitals bearing 10-11 pores. Four pores with small ventral branches (two in infraorbital 2; one in infraorbital 3; one in infraorbital 4) and one pore with a small dorsally oriented branch in infraorbital 6. Infraorbital 5 lacking pores. Laterosensory pores on dorsal surface of head disposed as follows: two pores on nasals, four pores on frontals, the anteriormost close to the orbit followed posteriorly by three pores laterally arranged. Two pores on the pterotic bones and two pores on the extra-scapular bones. Sometimes one extra-scapular pore displaced to the suprapreopercle bones. One pore in the posterior end of the symphysis between parietal bones. Six laterosensory pores in the preopercle. Total vertebrae count 39-40 (n = 3).
Colour in alcohol
Specimens as small as 40 mm of SL display a conspicuous dark, wide midlateral band over a brown background. Both, dorsal and ventral margins of this band ornamented with regularly spaced lights dots. Below this band, the ventral flank scattered with small irregular light spots and stripes. In larger specimens (over 50 mm of SL) these light marks larger, fused each other and, beyond midlateral dark band losses wideness. In both cases, a clear stripe evident below the dark band in the head, from the contact between the orbit margin and the 5 th infraorbital throughout the entire length of the fourth infraorbital. Lateral blotches, that will be the outstanding colour feature in larger specimens, incipiently visible. Individuals over 80 mm already reach the final coloration. A paler background colour and at least eight lateral posterior-oriented chevron blotches, irregularly spaced with decreasing separation between them as blotches proceed backwards. The midlateral band as well as most strik- ing coloration features of smaller individuals, completely lost. Instead, larger specimens with a dark circular spot in the dorsal extreme of caudal fin-base rays. Ventral surface of body pale-yellowish. All fins light brown with dark spots on rays and interradial membrane forming pattern of irregular dark stripes. This pattern more conspicuous in larger individuals.
Distribution
Hoplias misionera n. sp. is known from several locali- ties of northeastern Argentina in the Uruguay, Paraná and Paraguay River basins and one locality in the upper Parana River , in Brazil ( Fig. 4 View Figure 4 ). The type locality in Argentina is a small lotic stream ( 27°27’44.63”S; 54°57’5.58”W) tributary of the Acaraguá River system, in the Uruguay River basin. As most mountain streams in Misiones province , bottom is dominated by basalt rock due to the geological nature of the soils in this region. This stream is originated by a great number of little wellsprings, which drain the excess of water from the central hills. Stream width varies between 2 to 5 m, depending on the characteristic of the margins. Riparian native vegetation is dominated by native rain forest trees and several woody debris and other natural occurring lodges are a common feature GoogleMaps .
Etymology
The specific epithet misionera is named in reference to the Argentine province containing the type locality and also because small streams in Misiones province commonly host several species of Hoplias . Indeed, Misiones province also contains the type locality of the recently described Hoplias mbigua ( Azpelicueta et al., 2015) . Moreover, several specimens used in the original description of Hoplias australis ( Oyakawa and Mattox, 2009) were collected in this province.
Barcode Sequence
The mtDNA COI Barcode profile (652 bp) of the holotype is reported herein as an aspect of the type description: CCTGTATCTAGTATTTGGTGCCTGAGCCGGAATAGTTGGTACAGCTC
C A G C C T T C T A A T C C G A G C A G A G C T A A G C C A A C C C G G G G C A
TACTTGGCGATGACCAGATTTATAATGTTATCGTTACTGCACA
GCCTTCGTAATAATTTTCTTCATAGTAATGCCTATTATAATC
GGGGATTTGGAAACTGACTTGTTCCCCTCATGATTGGAGCACCTG
CATAGCCTTCCCGCGAATAAATAACATAAGTTTCTGGCTTC
TCCCCCCTCATTACTTCTCCTACTAGCCTCCTCCGGCGTAGAA
CAGGGGTAGGTACAGGTTGAACTGTTTACCCCCCTCTAGCC GAAACCTTGCACATGCAGGGGCCTCTGTTGACCTAGCAATTTT
T C T C T T C A T C T T G C A G G G G T C T C C T C A A T T T T A G G A G C T A
TAATTTTATTACAACAATTATTAACATAAAACCCCCTGCCAT
T C A C A A T A T C A A A C C C C C T T A T T T G T T T G A G C T A T T T T A A
CACAGCCGTTCTTCTTCTCCTCTCCCTCCCCGTTCTTGCTGCC
GAATCACAATACTTTTAACAGACCGAAACCTTAACACCACT
TCTTTGACCCCGCAGGAGGGGGAGATCCCATTCTTTATCAACATCTA
The nucleotide composition was A (157), G (114), C (178) and T (203). The K2P genetic distances within Hoplias misionera averaged 0.3% (0-0.77%). All specimens of H. misionera received the BIN AAB1732 from BOLD and differed by 5.61% from the nearest neighbour species. The K2P/NJ tree together with the BIN algorithm unambiguously discriminated among H. misionera and the remaining two clusters of the H. malabaricus species complex from lower Plata basin ( Fig. 5 View Figure 5 ).
Comparative material examined
Hoplias malabaricus . South America, probably Suriname (not “ Tranquebar ”): lectotype ZMB 3515 View Materials , 1 ex., 167 mm SL ; paralectotype ZMB 33059 View Materials , 1 ex., 69 mm SL, photos and X-rays .
Hoplias cf. malabaricus . Las Nutrias stream, Luján River Basin, Buenos Aires : UNMDP 1247 , 1 ex., 45 mm SL; UNMDP 1248 , 1 ex., 43 mm SL; UNMDP 1249 , 1 ex., 55 mm SL, J.J. Rosso coll., 02 May 2011 ; Salto Grande Reservoir, Entre Ríos : UNMDP 1279 , 1 ex., 240 mm SL, Rosso and Mabragaña coll., 12 Sep. 2011 ; Paraná-Guazú River, Delta of Paraná River, Entre Ríos : UNMDP 1370 , 1 ex., 309 mm SL ; UNMDP 1371 , 1 ex., 265 mm SL, Rosso, Mabragaña, Avigliano and Schenone coll., 07 Oct. 2011 ; Bergara stream, Entre Rios : UNMDP 1595 , 1 ex., 98 mm SL, Rosso and Mabragaña coll., 09 Sep. 2011 ; El Pescado Lake, Paraná River floodplain, Victoria , Entre Ríos : UNMDP 2452 , 1 ex., 202 mm SL ; UNMDP 2453 , 1 ex., 203 mm SL, Rosso and Mabragaña coll., 11 Nov. 2012 ; Nogoyá stream, Paraná River Basin, Entre Ríos : UNMDP 2565 , 1 ex., 134 mm SL, Rosso and Mabragaña coll., 10 Nov. 2012 ; Ayuí stream, Uruguay River Basin, Entre Ríos : UNMDP 2616 , 1 ex., 116 mm SL, Rosso and Mabragaña coll., 14 Nov. 2012 ; Rojas River, Paraná Basin, Ascensión, Buenos Aires : UNMDP 492 , 1 ex., 410 mm SL ; UNMDP 502 , 1 ex., 170 mm SL ; UNMDP 503 , 1 ex., 145 mm SL ; UNMDP 504 , 1 ex., 159 mm SL, Rosso, Vil- lamil, González-Castro and Mabragaña coll., 10 Dec. 2010 .
Hoplias mbigua . Parana River in Nemesio Parma , Dep. Capital, Misiones province, Argentine: holotype , CI-FML 6763, 1 ex., 224 mm SL, D. Aichino, M. Azpelicueta, D, Méndez, I. Rodriguez coll., Nov. 2005; CI-FML 6764, 2 ex., 224-248 mm SL, paratyypes, collected with the holotype.
Hoplias teres . Lake Maracaibo , Venezuela: syntypes MNHN-4377_1, 1 ex., 121 mm SL; MNHN-4377_2, 1 ex., 116 mm SL .
Hoplias microlepis . Rio Chagres , Panamá, lectotype, BMNH 1860.1 .26.221, 1 ex., photograph; paralectotype BMNH 1860.1 .26.222, 1 ex., photograph; Llano Sucio River, Atlantic Drainage, Panamá: LBV-18503, 1 ex., 215 mm SL, C Oliveira, RG Reina, C Vega, S Perez coll., 14 Jul. 2005 .
Erythrinus macrodon . Lake Almada , province of Bahia, and Rio São Francisco, Brazil: holotype: MHNN 0773 View Materials , 1 ex., photos and X-rays .
Macrodon tareira . Brazil and French Guiana: syntypes: MNHN 4409 About MNHN , 1 ex., 108 mm SL ; MNHN 4421 About MNHN , 3 ex., 175-237 mm SL ; MNHN A-9746, 1 ex., 93,4 mm SL ; MNHN A-9747, 1 ex., 183 mm SL ; MNHN A-9748, 1 ex., 245 mm SL .
Hoplias lacerdae . Ramos stream, Uruguay River Basin , Oberá, Misiones: UNMDP 570 , 1 ex., 346 mm SL; UNMDP 571 , 1 ex., 350 mm SL; UNMDP 594 , 1 ex., 163 mm SL, Rosso, Mabragaña, Avigliano and Schenone coll., 05 Feb. 2011 ; Yabotí River , Uruguay River Basin , Misiones: UNMDP 2725 , 1 ex., 192 mm SL; UNMDP 2735 , 1 ex., 244 mm SL, Rosso and Díaz de Astarloa coll., 18 Nov. 2012 .
Hoplias australis . Ramos stream, Uruguay River Basin , Oberá, Misiones: UNMDP 1991 , 1 ex., 43.9 mm SL, Rosso, Avigliano and Schenone coll., 06 Apr. 2012 ; Oveja Negra stream, Yabotí River Basin , Misiones: UNMDP 2721 , 1 ex., 271 mm SL; UNMDP 2722 , 1 ex., 220 mm SL; UNMDP 2723 , 1 ex., 171 mm SL; UNMDP 2724 , 1 ex., 166 mm SL, Rosso and Díaz de Astarloa coll., 18 Nov. 2012 .
Hoplias aimara . Cayenne , French Guiana: holotype, MNHN A-9968 (dry mount), 1 ex., 770 mm SL .
Hoplias curupira . Rio Amazonas / Rio Tapajós, Itaituba, Brazil: LBV 67349, 1 ex., 153 mm SL, R. Britzke coll., 11 Jun. 2012 .
Hoplias intermedius . San Francisco River , Gararu, Brazil: LBV 48702, 1 ex., 231 mm SL, Mehanna and Milano coll., 21 Nov. 2010 .
R |
Departamento de Geologia, Universidad de Chile |
V |
Royal British Columbia Museum - Herbarium |
MNHN |
Museum National d'Histoire Naturelle |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.