Emesis (Mandania) mandora, Grishin, 2024

Emesis (Mandania) mandora Grishin, new species

http://zoobank.org/ E7455377-B43E-415E-AAAB-2A760E201C04

( Fig. 2 View Figure 2 part, 23–24, 91–92)

Definition and diagnosis. As discussed above, a genetically and phenotypically distinct specimen from Ecuador ( Fig. 2 View Figure 2 orange) represents a new species of the subgenus Mandania Grishin, 2019. This new species is phenotypically similar to other Mandania and differs from its closest relatives by being paler and less saturated in color (i.e., plainer, less red, grayer) than E. mandana , but with a more contrasting pattern of dark spots and bands than E. furor , and broader wings than E. russula . The holotype is also notably larger than a typical Mandania ( Fig. 19–26 View Figures 7–26 ), and the size may be one of the characters for the new species. However, the size is typically variable, and without a series of specimens, it is not possible to ascertain. In female genitalia ( Fig. 91–92 View Figures 81–106 ), ductus bursae with a loop near a spherical corpus bursae, two very large (about ½ of the corpus diameter) horn-like signa at the caudal end of corpus, signum is more curved and with a larger base compared to its length, sternite VII (“genital plate”) with posterior margin shaped as a broad V less rounded on the sides and in the middle. Due to unexplored phenotypic variation and males still unknown, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 1684.6.12:G143A, cne3364.6.1:A299G, cne 2551.8.1:A315G, cne 2551.8.1:C327T, cne350.7.4:T726C, cne399.1.1:T225T (not G), cne 2564.2.1:A56A (not T), cne6857.5.3:A318A (not G), cne6857.5.3:T375T (not A), cne 1186.1.1:A119A (not T), and COI barcode: C50C, T106T, T235T, A412A, T581T, T595C.

Barcode sequence of the holotype. Sample NVG-18045H12, GenBank PQ203551, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCACTAAGATTATTAATTCGAATAGAATTAGGAACTTCAG GATCATTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTTCCACGAATAAATAATATAAGAT TTTGACTTTTACCTCCATCTTTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCTTCTAATATTGCTCATGGAGGTTCTTCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATT TTAGGTGCAATTAACTTTATTACTACTATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAT CTGTAGGAATTACAGCTCTTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAACTT AAATACATCATTCTTTGATCCTGCTGGTGGTGGTGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 23–24 View Figures 7–26 , bears the following six printed rectangular labels, five white: [ Riodinidae V-31-1978 | Emesis fatima M | SDLC, Ecuador, 1800 ft], [DNA sample ID: | NVG-18045H12 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23114G09 | c/o Nick V. Grishin ], [genitalia | NVG240817-14 | Nick V. Grishin ], [USNMENT | {QR Code} | 00940170], and one red [HOLOTYPE ♀ | Emesis (Mandania) | mandora Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection.

Type locality. Ecuador: Santo Domingo de los Colorados, elevation 550 m.

Etymology. The name is a modified fusion of the name of a related species with the name of the country with the type locality: mand [an] + [Ecua] dor + a. The name is treated as a feminine noun in apposition.

Distribution. Currently known only from the holotype collected in Ecuador.