Emesis (Mandania) manduza, Grishin, 2024

Emesis (Mandania) manduza Grishin, new species

http://zoobank.org/ 9C0ED1F0-211A-4588-B534-E3292AD60323

( Fig. 2 View Figure 2 part, 25–26, 93–94)

Definition and diagnosis. As discussed above, a genetically and phenotypically distinct specimen from Peru ( Fig. 2 View Figure 2 magenta) represents a new species of the subgenus Mandania Grishin, 2019. This new species is phenotypically similar to other Mandania and differs from its closest relatives by being darker, dorsally more maroon than orange, orange-red, or brown; in particular, the difference in darkness is more obvious towards the apex and costal margin of the dorsal hindwing and on the ventral side, towards the margins. Due to unexplored phenotypic variation in this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne216.12.3:T242C, cne216.12.3:T414A, cne216.12.3:A426T, cne9580.1.6:T99G, cne9580.1.6:G111T, cne5285.1.8:C60C(not T), cne5285.1.8:C81C (not T), cne5285.1.8:G114G (not A), cne6560.2.3:A489A (not T), cne6560.2.3:T504T (not C), and COI barcode: C50C, T106T, T235T, A388G, A412A, T581C, T595T.

Barcode sequence of the holotype. Sample NVG-18044D07, GenBank PQ203552, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCACTAAGATTATTAATTCGAATAGAATTAGGAACTTCAG GATCATTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTTCCACGAATAAATAATATAAGAT TTTGACTTTTACCTCCATCTTTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCTTCTAATATTGCTCATGGAGGTTCTTCAGTAGATTTGGCTATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATT TTAGGTGCAATTAACTTTATTACTACTATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAT CTGTAGGAATTACAGCTCTTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTAACAGATCGAAATTT AAATACATCATTCTTTGATCCTGCTGGTGGTGGTGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 25–26 View Figures 7–26 , bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PERU: Cuzco, 1050m | Quitacalzón | Cosnipata Valley 4856 | 01-XI-2016 Kinyon], [DNA sample ID: | NVG-18044D07 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23114G10 | c/o Nick V. Grishin ], [genitalia | NVG240817-15 | Nick V. Grishin ], [USNMENT | {QR Code} | 01466363], and one red [HOLOTYPE ♂ | Emesis (Mandania) | manduza Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection.

Type locality. Peru: Cuzco Department, Cosñipata Valley, Quebrada Quitacalzón, elevation 1050 m, GPS −13.0167, −71.4833.

Etymology. The name is a modified fusion of the name of a related species with the name of the Peruvian region with the type locality: mand [an] + [c] uz [co] + a. The name is treated as a feminine noun in apposition.

Distribution. Currently known only from the holotype collected in southern Peru.

Emesis (Tenedia) tristis Stichel, 1929 is a species distinct from Emesis (Tenedia) lupina Godman and Salvin, 1886

Genomic analysis reveals that Emesis tristis Stichel, 1929 (type locality in Mexico: Colima, syntype sequenced as NVG-18043E08) currently regarded as a junior subjective synonym of Emesis (Tenedia) lupina Godman and Salvin, 1886 (type locality in Costa Rica) ( Zhang et al. 2019b), while being closely related to it, is genetically differentiated from it at the species level ( Fig. 3 View Figure 3 ), e.g., their COI barcodes differ by 2.3% (15 bp). In the presence of recognizable phenotypic differences— E. tristis of both sexes being darker in ground color, with less contrasting spots and bands compared to E. lupina —we propose to treat Emesis (Tenedia) tristis Stichel, 1929 , reinstated status, as a species-level taxon.