Emesis (Emesis) bartica, Grishin, 2024

Emesis (Emesis) bartica Grishin, new species

http://zoobank.org/ 5C122118-275F-4682-A81C-F499174B98C3

( Fig. 1 View Figure 1 part, 13–14)

Definition and diagnosis. Genomic analysis of Emesis [Fabricius], 1807 reveals that a specimen from Guyana ( Fig. 1 View Figure 1 aquamarine) is genetically differentiated from its sister Emesis (Emesis) aerigera ( Stichel, 1910) (type locality in Brazil: Sao Paulo, syntype sequenced as NVG-18054D07) ( Fig. 1 View Figure 1 brown) at the species level, e.g., their COI barcodes differ by 4.0% (26 bp). Therefore, this specimen represents a new species. This new species is phenotypically similar to E. aerigera and differs from it by narrower metallic bands with less interconnected and aligned spots, a metallic postdiscal spot in the forewing cell M 1 -M 2 being stronger offset basad from the band, and forewings with slightly less hooked apex. In addition to the holotype of the new species ( Fig. 13–14 View Figures 7–26 ), we also illustrate a syntype, a male, of E. aerigera (NVG-18054D07 Brazil: Sao Paulo, Casa Branca, 1890, Garbe leg. [MFNB]) ( Fig. 11–12 View Figures 7–26 ). Furthermore, see iNaturalist observation 160938035 of E. aerigera female from Brazil: Santa Catarina for comparison (iNaturalist 2024). Due to unexplored phenotypic variation in this species and males still unknown, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 2800.4.2:T142A, cne6221.18.5:T129C, cne6221.18.5:A144G, cne15953.4.2:T15A, cne15953.4.2:A51G, cne 2337.3.4:A45A (not T), cne 2337.3.4:T48T (not C), cne7747.1.14:C116C (not G), cne7747.1.14:C120C (not G), cne4614.6.1:C264C (not T), and COI barcode: T49T, T103C, A238A, T373C, T442C, T553C.

Barcode sequence of the holotype. Sample NVG-18048H03, GenBank PQ203546, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGTACATCTTTAAGTTTATTAATTCGTATAGAATTAGGAACTTCTG

ATAATTGGAGGATTTGGTAATTGGTTAGTTCCTCTTATATTAGGAGCCCCTGATATAGCATTCCCACGTATAAATAATATAAGAT TTTGATTATTACCCCCATCCTTATTTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCTAATATTGCTCATGGAGGCTCTTCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATTTCTTCTATT TTAGGAGCAATTAACTTTATTACAACTATTATTAATATACGAATTAATAATATATCTTTTGATCAAATACCTTTATTTGTTTGAT CTGTAGGAATTACTGCTCTTTTATTATTACTATCTCTTCCCGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGTAATTT AAATACATCTTTTTTTGACCCAGCAGGTGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♀ deposited in the National Museum of Natural History , Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 13–14 View Figures 7–26 , bears the following four printed rectangular labels, three white: [Bartica | Bartica District | British Guiana], [DNA sample ID: | NVG-18048H03 | c/o Nick V. Grishin ], [USNMENT | {QR Code} | 01466572], and one red [HOLOTYPE ♀ | Emesis (Emesis) | bartica Grishin]. The holotype lacks its abdomen.

Type locality. Guyana: Cuyuni-Mazaruni Region, Bartica.

Etymology. The name is given for the type locality and is a feminine noun in apposition. Furthermore, the name Bartica comes from an Amerindian word, possibly Arawakan or Cariban, that means “red earth,” and seems suitable for this reddish-colored species.

Distribution. Currently known only from the holotype collected in Guyana.

Emesis (Emesis) nobilata Stichel, 1910 is a species distinct from Emesis (Emesis) fatimella Westwood, 1851

Genomic analysis reveals that Emesis fatima nobilata Stichel, 1910 (type locality in Costa Rica, syntype sequenced as NVG-18052D01) currently regarded as a subspecies of Emesis (Emesis) fatimella Westwood, 1851 (type locality in Suriname and Brazil: Amazonas) ( Callaghan and Lamas 2004) is genetically differentiated from it at the species level ( Fig. 1 View Figure 1 ), e.g., their COI barcodes differ by 2.9% (19 bp). In the presence of recognizable phenotypic differences—males of E. fatimella nobilata have darker ground color and larger, more diffuse spotting compared to the nominate subspecies—we propose to treat Emesis (Emesis) nobilata Stichel, 1910 , new status, as a species-level taxon.