Emesis ( Emesis ) fatimellina, Grishin, 2024
publication ID |
https://doi.org/10.5281/zenodo.14662420 |
publication LSID |
lsid:zoobank.org:pub:EFB3CF5F-6748-41D0-B905-E9CFC8F54D2C |
persistent identifier |
https://treatment.plazi.org/id/03BF8783-FF85-FFC4-FF23-FB5999D8FC9A |
treatment provided by |
Felipe |
scientific name |
Emesis ( Emesis ) fatimellina |
status |
new species |
Emesis ( Emesis) fatimellina Grishin, new species
http://zoobank.org/ FAE56D8B-3EF1-4E43-B997-CB21188D67C7
( Fig. 1 View Figure 1 part, 15–16, 81–82)
Definition and diagnosis. Genomic analysis of Emesis [Fabricius], 1807 reveals that two specimens from Southeast Brazil and South Brazil ( Fig. 1 View Figure 1 red) form a clade sister to both Emesis ( Emesis) nobilata Stichel, 1910 , new status ( type locality in Costa Rica) and Emesis ( Emesis) fatimella Westwood, 1851 ( type locality in Suriname and Brazil: Amazonas) and are genetically differentiated from their relatives ( Fig. 1 View Figure 1 cyan, blue, and magenta) at the species level, e.g., their COI barcodes differ by 4.1%–4.6% (27–30 bp). Therefore, these specimens represent a new species. This new species is phenotypically similar to E. nobilata and E. fatimella and differs from its relatives by the ground color that is paler and more orange than in E. nobilata , but yellower (rather than orange) beneath compared even to E. fatimella , sharper defined and less diffuse dark markings on the dorsal side, and generally smaller submarginal brown spots on the ventral side; these spots are not all the same size and the size difference among them appears more pronounced than in other species. In male genitalia ( Fig. 81–82 View Figures 81–106 ), the lower valval projection is not developed, the upper projection is claw-like with the inner broad tooth, aedeagus terminally with several stronger sclerotized broad teeth around the posterior margin. Due to unexplored phenotypic variation in this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne11524.2.14:G153A, cne877.3.6:T267C, cne764.2.12:C144T, cne764.2.12:C154A, cne6813.1.17:G103T, and COI barcode: A1T, T169A, T232C, A433T, T526C, T646C.
Barcode sequence of the holotype. Sample NVG-18044H01, GenBank PQ203547, 658 base pairs: TACATTATATTTTATTTTTGGTATTTGAGCCGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAG GATCTTTAATTGGCGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATT ATAATTGGCGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCCTTCCCACGTATAAATAATATAAGAT TTTGATTATTACCTCCATCTTTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC
CCCACTTTCATCTAATATTGCTCATGGTGGATCTTCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCTTCTATT TTAGGTGCTATTAATTTTATTACTACTATTATTAACATACGAATTAATAATATATCATTTGATCAAATACCATTATTTGTTTGAT CAGTAGGAATTACCGCTCTTTTATTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACAGATCGTAATTT AAATACATCATTTTTTGATCCAGCTGGTGGTGGAGATCCAATTTTATACCAACATTTATTT
Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 15–16 View Figures 7–26 , bears the following six printed (text in italics handwritten) rectangular labels, five white: [ Brasil: Santa Catarina | Joinville: 10-200 m | 26 Feb 1991 | Leg. H. Miers], [DNA sample ID: | NVG-18044H01 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23114G04 | c/o Nick V. Grishin ], [genitalia | NVG240817-09 | Nick V. Grishin ], [USNMENT | {QR Code} | 01466402], and one red [ HOLOTYPE ♂ | Emesis (Emesis) | fatimellina Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratype: 1♂: NVG-18052G08 Brazil: Rio de Janeiro, Teresópolis, coll. H. Stichel number 3305 [ MFNB].
Type locality. Brazil: Santa Catarina, Joinville.
Etymology. The name is formed from the name of its South American relative, E. fatimella , which is made longer for this more southern species and is treated as a feminine noun in apposition.
Distribution. Southeast and South Brazil.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |