Emesis (Emesis) panamella, Grishin, 2024

Emesis (Emesis) panamella Grishin, new species

http://zoobank.org/ 02586855-7FA6-4F8F-AAC5-15D46FF43F03

( Fig. 1X View Figure 1 part, 17–18, 83–84)

Definition and diagnosis. A more detailed comparison of Emesis (Emesis) fatimella Westwood, 1851 (type locality in Suriname and Brazil: Amazonas) relatives reveals that in addition to the most genetically divergent species, Emesis (Emesis) fatimellina , new species, a specimen from Panama ( Fig. 1 View Figure 1 magenta) is not tightly clustered with either Emesis (Emesis) nobilata Stichel, 1910 , new status (type locality in Costa Rica) ( Fig. 1 View Figure 1 cyan) or E. fatimella ( Fig. 1 View Figure 1 blue) and instead is genetically differentiated from them at the species level, e.g., their COI barcodes differ by 2.4% (16 bp) from E. nobilata and by 3.2% (21 bp) from E. fatimella . Therefore, this specimen represents a new species. This new species is phenotypically similar to E. nobilata and E. fatimella and differs from them by the color of both sides of wings being brighter orange than in E. nobilata , and by more deep orange (rather than yellower) colors compared to E. fatimella , approximately the same color of dorsal and ventral side of wings (ventral is typically yellower than dorsal in E. fatimella ), and usually sharper defined and less diffuse submarginal spots on forewing, and whiter scales on thorax, basal half of legs and abdomen beneath. In male genitalia ( Fig. 83–84 View Figures 81–106 ), the lower valval projection is much smaller, directed inward, the upper projection is strongly elongated, longer than falces, claw-like with the inner broad tooth, aedeagus is narrower and longer. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 2539.10.4:T57C, cne33461.1.2:A87G, cne7180.6.10:A120G, cne7180.6.10:T174A, cne65262.1.1:A648G, cne254622.4.2:G30G (not A), cne254622.4.2:A42A (not G), cne3597.4.3:A73A (not G), cne3597.4.3:C74C (not A), cne3597.4.3:C85C (not T), and COI barcode: A85A, T361C, A379C, T533C, A604C.

Barcode sequence of the holotype. Sample NVG-18044G07, GenBank PQ203548, 658 base pairs: AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCATTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAG GATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGTGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGTATAAATAATATAAGAT TTTGATTATTACCTCCATCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCAAATATCGCTCATGGCGGATCTTCCGTAGATTTAGCTATTTTTTCCTTACATTTAGCTGGTATTTCTTCTATT TTAGGAGCTATTAATTTTATTACTACTATTATTAACATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTATGAT CTGTAGGAATTACTGCTCTTCTATTATTATTATCTCTACCCGTATTAGCAGGAGCTATTACCATATTATTAACAGATCGTAATTT AAATACCTCATTCTTTGATCCAGCTGGTGGTGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 17–18 View Figures 7–26 , bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PANAMA: DARIEN | Cana (Cerro Pirre) | 1000m | 7°56’N 77°43’W | 31 I 1984 | leg. G.B.Small], [DNA sample ID: | NVG-18044G07 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23114G05 | c/o Nick V. Grishin ], [genitalia | NVG240817-10 | Nick V. Grishin ], [USNMENT | {QR Code} | 01466396], and one red [HOLOTYPE ♂ | Emesis (Emesis) | panamella Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection.

Type locality. Panama: Darién Province, Cana, Cerro Pirre , elevation 1000 m, approx. GPS 7.933 3, −77.7167.

Etymology. The name is a fusion of the type locality country name with the name of a relative from South America: Pana [ma[+ [fati] mella. The name is treated as a feminine noun in apposition.

Distribution. Currently known only from the holotype collected in eastern Panama.