Emesis (Emesis) aerunda, Grishin, 2024

Emesis (Emesis) aerunda Grishin, new species

http://zoobank.org/ 7ADDFF04-F4DC-4379-AE2E-59B99593C46E

( Fig. 1 View Figure 1 part, 7–8)

Definition and diagnosis. Genomic analysis of Emesis [Fabricius], 1807 reveals that a specimen from Peru ( Fig. 1 View Figure 1 orange) is genetically differentiated from its sister Emesis (Emesis) orichalceus Stichel, 1916 (type locality in Bolivia, syntype sequenced as NVG-18043E06) ( Fig. 1 View Figure 1 olive-colored clade) at the species level, e.g., their COI barcodes differ by 2.1% (14 bp). Therefore, this specimen represents a new species. This new species is phenotypically similar to E. orichalceus and Emesis neemias Hewitson, 1872 (type locality in Brazil) and differs from its relatives by postdiscal and submarginal bands of metallic crescents on hindwing being farther from each other, less orange-red and more purplish ventral side of wings with more prominent pale ray near the anal margin of hindwing, and typically larger and more diffuse tornal dark spots on ventral side of both wings. In addition to the holotype of the new species ( Fig. 7–8 View Figures 7–26 ), we also illustrate a typical male of E. orichalceus (NVG-18045D03, USNMENT 01466452 Bolivia: La Paz Province, San Lorenzo Valley, Rio San Lorenzo, 800 m, GPS −15.8056, −67.4908, Brian Harris leg. [USNM]) ( Fig. 9–10 View Figures 7–26 ). Due to unexplored phenotypic variation in the new species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 1775.9.1:T306C, cne 1775.9.1:A795G, cne403.3.3:A120G, cne403.3.3:T135C, cne4207.3.2:C32G, cne253.1.13:G171G (not A), cne10789.3.8:A150A (not G), cne 2851.12.1:C104C (not A), cne 2851.12.1:A123A (not G), cne13070.7.1:G1255G (not A), and COI barcode: T34A, A130T, T133C, 169C, T484T.

Barcode sequence of the holotype. Sample NVG-18052F04, GenBank PQ203545, 658 base pairs: AACATTATATTTTATCTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACCTCAG GCTCATTAATTGGAGATGACCAAATTTATAATACTATTGTAACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATT ATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATACTTGGAGCACCAGATATAGCATTTCCACGTATAAATAATATAAGAT TTTGATTATTACCTCCTTCTTTATTTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCAAATATTGCTCATGGAGGATCTTCTGTTGATTTAGCTATTTTTTCATTACATTTAGCTGGTATTTCTTCTATT TTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCATTATTTGTTTGAT CAGTAGGAATTACAGCTCTTTTATTATTATTATCTTTACCTGTATTAGCTGGAGCTATTACTATATTATTAACAGATCGTAATTT AAATACATCATTTTTTGATCCTGCTGGAGGAGGAGACCCAATTTTATATCAACACTTATTT

Type material. Holotype: ♂ currently deposited in the Museum für Naturkunde, Berlin, Germany ( MFNB), illustrated in Fig. 7–8 View Figures 7–26 , bears the following four rectangular labels (1 st green, last red, others white; 2 nd handwritten, others printed): [Mt. Alegre, Rio | Pachitea O. Peru | G.Tessmann], [DNA sample ID: | NVG-18052F04 | c/o Nick V. Grishin ], [ neemias Hew. ], and [HOLOTYPE ♂ | Emesis (Emesis) | aerunda Grishin].

Type locality. Peru: Rio Pachitea, Monte Alegre. This is also the type locality of Pseudophaloe tessmanni Hering, 1925 ( Erebidae : Arctiinae), Hylesia natex Draudt, 1929 ( Saturniidae ), and Synargis flavicauda Grishin, 2023 ( Riodinidae ), among others.

Etymology. In Latin, aeruginosus means brassy or verdigris-colored, and unda means wave. The name is given for the metallic green wavy pattern of this species: aeru [ginosus] + [u] nda and is treated as a feminine noun in apposition.

Distribution. Currently known only from the holotype collected in central Peru.