Emesis (Aphacitis) auripana, Grishin, 2024

Emesis (Aphacitis) auripana Grishin, new species

http://zoobank.org/ C51B6181-7DA5-4330-AC99-2AEFBA530032

( Fig. 5 View Figure 5 part, 63–66, 121–122)

Definition and diagnosis. This new species ( Fig. 5 View Figure 5 purple) is sister to both Emesis (Aphacitis) aurimna (Boisduval, 1870) (type locality in Colombia) and Emesis (Aphacitis) parvissima Kaye, 1921 , new status (type locality in Trinidad) in the nuclear genome trees, and therefore is distinct from either of them. In the COI barcodes, the difference is 2% (13 bp) from E. aurimna and 2.1% (14 bp) from E. parvissima . This new species is phenotypically similar to others in the E. aurimna clade and differs from its relatives by a combination of the following characters in female: white forewing subapical area is less extensive (but not as small as in E. parvissima ), consists of smaller spots and not as prominently extending along veins towards the apex as in E. aurimna , and the apical separate white spot is smaller. Ventral hindwing is more similar to E. aurimna and E. parvissima in pattern, with submarginal inverted crescents separated from each other, with smaller spots there, white not prominently extending along veins towards apex, and the very apical separate spot is smaller as well. In males, white subapical frosting on the dorsal forewing is present (not vestigial as in E. parvissima ) but less extensive than in E. aurimna ; ventrally, wings are slightly yellower and weaker patterned. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne4410.1.5:G204A, cne4410.1.5:G210A, cne2706.1.64:A165G, cne793.4.4:A96T, cne793.4.4:A165G, and COI barcode: A61A, T88C, T130T, T247T, T610C.

Barcode sequence of the holotype. Sample NVG-18044E02, GenBank PQ203563, 658 base pairs: AACATTATACTTTATTTTTGGAATTTGATCAGGAATAGTCGGCACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACCTCAG GCTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGAGGATTTGGTAACTGATTAGTTCCATTAATATTAGGAGCACCTGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGACTTTTACCACCATCATTAATTTTATTAATTTCAAGAAGAGTTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCTAATATTGCCCATGGAGGAGCCTCAGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATTTCATCTATT TTGGGAGCAATTAATTTTATCACAACAATCATTAATATACGTATTAATAATATGTCATTTGATCAAATACCATTATTTGTCTGAT CTGTTGGAATTACAGCTCTTTTACTTTTATTATCTCTTCCAGTTTTAGCCGGAGCTATTACTATATTATTAACAGATCGTAATTT AAATACATCTTTCTTTGACCCTGCTGGGGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 63–64 View Figures 63–70 , bears the following six printed rectangular labels, five white: [ PANAMA: Darién | Canglón | 14.ix.1980 | leg. G. B. Small], [DNA sample ID: | NVG-18044E02 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23114H08 | c/o Nick V. Grishin ], [genitalia | NVG240817-27 | Nick V. Grishin ], [USNMENT | {QR Code} | 01466369], and one red [HOLOTYPE ♂ | Emesis (Aphacitis) | auripana Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratypes: 1♂ and 1♀ from Panama [ USNM]: 1♂ NVG-18044C12 USNMENT 01466357 Darién, Cana , 400 m, 20-Sep-1982, G. B. Small leg., genitalia #2003- 46, Donald J. Harvey; 1♀ NVG-18044E01, USNMENT 01466368, Panamá, Taboga Island, 1-Nov-1983, J. F. G. Clarke ( Fig. 65–66 View Figures 63–70 ).

Type locality. Panama: Darién Province, Canglón.

Etymology. The name for this E. aurimna relative from Panama is formed as a fusion: auri [mna] + Pana [ma] and is treated as a feminine noun in apposition.

Distribution. Central and eastern Panama.