Emesis (Aphacitis) pruinapicalis, Grishin, 2024

Emesis (Aphacitis) pruinapicalis Grishin, new species

http://zoobank.org/ 0F94E2B7-C12F-4BE9-A643-B94414C23302

( Fig. 5 View Figure 5 part, 67–68, 123–124)

Definition and diagnosis. This new species ( Fig. 5 View Figure 5 red) is sister to the clade that consists of Emesis (Aphacitis) aurimna (Boisduval, 1870) (type locality in Colombia), Emesis (Aphacitis) parvissima Kaye, 1921 , new status (type locality in Trinidad), and Emesis (Aphacitis) auripana , new species (type locality in Panama: Darién), in the nuclear genome trees, and therefore is distinct from all others. In the COI barcodes, the difference is 2.1% (14 bp) from E. aurimna , 2.6% (17 bp) from E. parvissima , and 2.0% (13 bp) from E. auripana . This new species is phenotypically similar to others in the E. aurimna clade and differs from its relatives by a combination of the following characters in male (female is unknown): dorsal forewing heavily frosted with white scales in the apical quarter, frosting reaches vein CuA 2 along the outer margin, white scales present in the postdiscal area between costa and vein M 2, separated from the subapical white overscaling by a darker olive-brown inverted-L-shaped postdiscal band, submarginal dark spots are not developed, giving this species a more “frosted” appearance; ventral side orange, yellower in the middle of cells and darker along the veins and dark bands and spots, mostly orange along out wing margins, with dark spots towards forewing tornus and at the hindwing apex. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne23605.2.8:C216T, cne3560.4.6:C232T, cne6180.2.5:A192G, cne471.1.1:A802C, cne 2676.3.1:T487C, cne426.6.1:A630A (not G), cne 2343.2.13:C183C (not A), cne 2343.2.13:T537T (not C), cne12832.2.1:A218A (not T), cne5563.4.3:G22G (not C), and COI barcode: T10T, T197C, A289G, A316G, A466G, T595C.

Barcode sequence of the holotype. Sample NVG-18044B07, GenBank PQ203564, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTCGGCACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACCTCAG GTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGAGGATTTGGTAACTGACTAGTTCCATTAATATTAGGAGCACCTGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGACTTTTACCACCATCATTAATTTTATTGATTTCAAGAAGAATTGTAGAAAATGGGGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCTAATATTGCCCATGGAGGAGCCTCAGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATTTCATCTATT TTAGGAGCAATTAATTTTATCACAACAATCATTAATATGCGTATTAATAATATGTCATTTGATCAAATACCATTATTTGTTTGAT CTGTTGGAATTACAGCTCTTTTACTTTTATTATCTCTTCCAGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGTAACTT AAATACATCTTTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 67–68 View Figures 63–70 , bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PANAMA: DARIEN | Cana (Cerro Pirre) | 400m | 7°56’N 77°43’W | 26 VII 1981 | leg. G.B.Small], [DNA sample ID: | NVG-18044B07 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23114H09 | c/o Nick V. Grishin ], [genitalia | NVG240817-28 | Nick V. Grishin ], [USNMENT | {QR Code} | 01466341], and one red [HOLOTYPE ♂ | Emesis (Aphacitis) | pruinapicalis Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection.

Type locality. Panama: Darién Province, Cana, Cerro Pirre , elevation 400 m, approx. GPS 7.933 3, −77.7167.

Etymology. In Latin, pruina means frost, and apicalis means apical or related to the apex. The name is given for the frosted apical part of the forewing and is a feminine adjective.

Distribution. Currently known only from the holotype collected in eastern Panama.