Emesis (Aphacitis) furvescens, Grishin, 2024
publication ID |
https://doi.org/10.5281/zenodo.14662420 |
publication LSID |
lsid:zoobank.org:pub:EFB3CF5F-6748-41D0-B905-E9CFC8F54D2C |
persistent identifier |
https://treatment.plazi.org/id/03BF8783-FF92-FFD0-FF23-FE359F23F936 |
treatment provided by |
Felipe |
scientific name |
Emesis (Aphacitis) furvescens |
status |
new species |
Emesis (Aphacitis) furvescens Grishin, new species
http://zoobank.org/ 4DAF6790-C417-46F3-A92D-AC27F794DD20
( Fig. 5 View Figure 5 part, 69–70, 125–126)
Definition and diagnosis. This new species ( Fig. 5 View Figure 5 aquamarine) is sister to Emesis (Aphacitis) glaucescens Talbot, 1929 (type locality in Colombia: Montepa) in the nuclear genome tree and genetically differentiated from it at the species level. Although their COI barcodes do not differ strongly, by 1.4% (9 bp), this difference is coupled with nuclear genome differentiation and phenotypic differences. This new species is phenotypically most similar to E. glaucescens and differs from it by a combination of the following characters in male (female is unknown): darker on both sides of wings, with reduced pale bluish-white frosting towards dorsal forewing apex, with dark submarginal spots in the frosted area, ventral side of wings with dark-brown margins, orangeyellow spots within this dark-brown border are lacking or vestigial, forewing submarginal area is orange and only slightly yellower than the ground color (not pale-yellow as in E. glaucescens ). Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 2149.1.2:C63G, cne 2149.1.2:A90T, cne392.2.10:C100T, cne392.2.10:G145A, cne3775.6.11:G87A, cne10177.2.4:T46T (not C), cne10177.2.4:T42T (not C), cne865.2.5:C159C (not T), cne13674.5.7:G70G (not A), cne13674.5.7:A75A (not T), and COI barcode: 133T, T397C, T463C, 481G, 616T.
Barcode sequence of the holotype. Sample NVG-18044C06, GenBank PQ203565, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTCGGCACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACCTCAG GTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGAGGATTTGGTAACTGATTAGTTCCATTAATATTAGGAGCACCTGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGACTTTTACCACCATCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCTAATATTGCCCATGGAGGAGCCTCAGTTGATTTAGCTATTTTCTCCCTTCATTTAGCTGGTATCTCATCTATT TTAGGAGCAATTAATTTTATCACAACAATCATTAACATACGTATTAATAATATGTCATTTGATCAAATACCATTATTTGTTTGAT CTGTTGGAATTACAGCTCTTTTACTTTTATTGTCTCTTCCAGTTTTAGCCGGAGCTATTACCATACTATTAACAGATCGTAATTT AAATACATCTTTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 69–70 View Figures 63–70 , bears the following five printed (text in italics handwritten) rectangular labels, four white: [ Panama: Darien | Cana 1000 m. | 4.IX.1982 | G.B. Small], [Genitalia Dissection | #2003 – 47 | Donald J. Harvey], [DNA sample ID: | NVG-18044C06 | c/o Nick V. Grishin ], [USNMENT | {QR Code} | 01466352], and one red [HOLOTYPE ♂ | Emesis (Aphacitis) furvescens Grishin].
Type locality. Panama: Darién Province, Cana , elevation 1000 m.
Etymology. In Latin, furvus means dark or dusky, and the name is formed similarly to the name of its relative E. glaucescens to mean becoming darker, given for the reduced bluish-white overscaling at the dorsal forewing apex and darker colors of the ventral side. The name is a participle.
Distribution. Currently known only from the holotype collected in eastern Panama.
USNM |
Smithsonian Institution, National Museum of Natural History |
V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |