Emesis (Brimia) apagada, Grishin, 2024

Emesis (Brimia) apagada Grishin, new species

http://zoobank.org/ B7A63CB1-2EDC-4641-9DE0-EB5D5A0271C8

( Fig. 4 View Figure 4 part, 55–56, 115–116)

Definition and diagnosis. This is a more northern species from the clade sister to Emesis (Brimia) temesa (Hewitson, 1870) (type locality in Ecuador) and is sympatric with it in Rondônia, Brazil. This new species is phenotypically similar to E. temesa and differs from it, including sympatric Emesis temesa peruviana (Lathy, 1904) (type locality in Peru: Junín) by the reduced red coloration of the ventral side, including much reduced red overscaling on ventral hindwing. Most notably, the forewing margin is brown (not largely reddish with a narrow brown frame towards the apex as is E. temesa ) including part of the area with the submarginal row of black spots. In male genitalia ( Fig. 115–116 View Figures 107–132 ), the posterior lobe in the middle of vinculum is longer and more triangular, uncus is narrower and with a more prominent central bulge, saccus and the lower valval projection are longer, the upper valval projection is only slightly curved dorsad and outward. Due to unexplored phenotypic variation in this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne6505.1.20:G347A, cne6505.1.20:T366C, cne4919.1.4:T36C, cne4919.1.4:A111G, cne10177.13.11:T75C, and COI barcode: A73G, A208G, A238T, T259C, C406T, A619C.

Barcode sequence of the holotype. Sample NVG-18045D08, GenBank PQ203560, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGTTTATTAATTCGTATGGAGTTAGGAACTTCAG GCTCTTTAATTGGAGATGATCAAATCTATAATACTATTGTAACAGCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCTATT

ATAATTGGTGGATTTGGAAATTGATTAGTACCTTTGATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGAT TCTGACTATTACCCCCATCATTATTTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCCTCTAATATTGCACATGGAGGTTCTTCAGTAGATTTAGCTATTTTTTCCTTACATTTAGCAGGAATTTCTTCAATT TTAGGAGCAATTAATTTTATTACTACAATCATTAATATACGAATTAATAATATATCATTTGACCAAATACCATTATTTGTTTGAT CAGTTGGAATTACTGCTTTATTATTATTATTATCCTTACCAGTATTAGCAGGTGCCATCACTATATTATTAACTGACCGTAACTT AAATACATCCTTTTTTGACCCCGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 55–56 View Figures 49–62 , bears the following six printed rectangular labels, five white: [ PERU, M. de Dios, Par- | que Manu, Pakitza 340m | 11°55’48”S 71°15’18”W | 12 Oct 1991 | Leg. M. Cassagrande], [DNA sample ID: | NVG-18045D08 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23114H05 | c/o Nick V. Grishin ], [genitalia | NVG240817-24 | Nick V. Grishin ], [USNMENT | {QR Code} | 01466457], and one red [HOLOTYPE ♂ | Emesis (Brimia) | apagada Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratype: 1♂ NVG-18045D11 USNM 01466460 Brazil: Rondonia, vic. Caucalandia, −10.533, −62.800 10-Oct-1991, J. Mac- Donald leg. [ USNM].

Type locality. Peru: Madre de Dios Region, Manu National Park, Pakitza, elevation 340 m, approx. GPS −11.930, −71.255.

Etymology. In Spanish, apagado means extinguished or muted, referring to the reduced flaming coloration of the ventral side of this species. The name is treated as a feminine adjective.

Distribution. From southeastern Peru to west-central Brazil.