Emesis (Tenedia) flecta, Grishin, 2024

Emesis (Tenedia) flecta Grishin, new species

http://zoobank.org/ 66B61DB6-8554-4B5C-B20D-81086B8CB475

( Fig. 3 View Figure 3 part, 49–52, 109–110)

Definition and diagnosis. Genomic sequencing reveals that several specimens from Ecuador, Peru, and Bolivia ( Fig. 3 View Figure 3 purple) form a clade sister to Emesis (Tenedia) cypria C. Felder and R. Felder, 1861 ( Fig. 3 View Figure 3 blue) which, in the nuclear genome, is genetically differentiated from it at the species level with Fst / Gmin of 0.31/0.015. In the mitochondrial genome, however, the differences are small, e.g., 0.6% (4 bp) in the COI barcode. This clade represents a new species, which is similar to E. cypria and differs from it by males with dark ventral forewing postdiscal band that is wider and stronger kinked at vein CuA 2, the segment in the CuA 2 -1A+2A cell is stronger offset distad than in E. cypria , and the two segments in this cell do not form into an arrowhead pointing basad. In male genitalia ( Fig. 109–110 View Figures 107–132 ), uncus is shorter than tegumen, lower valval projection is more robust and slightly tilted inward, the upper projection is more pointed and narrower in ventral view. Due to the cryptic nature of this species and poorly explored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne3772.6.14:C28T, cne686.4.4:A36C, cne686.4.4:A78G, cne686.4.4:A144G, cne 1307.2.3:T96C, and COI barcode (may not always distinguish this species): T364T, T442C, G586G, A628A.

Barcode sequence of the holotype. Sample NVG-18045H03, GenBank PQ203558, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAG GCTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATT ATAATTGGAGGATTTGGTAATTGATTAGTACCATTAATACTAGGAGCCCCAGACATAGCTTTTCCACGAATAAATAATATAAGAT TTTGATTATTACCCCCCTCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTGTACCC CCCACTTTCCTCTAATATTGCTCATGGAGGATCCTCAGTTGATTTAGCTATTTTTTCTTTACACTTAGCAGGTATTTCTTCTATT CTAGGAGCAATTAACTTTATTACCACTATCATCAATATACGAATTAATAACTTATCATTCGATCAAATACCTCTTTTTATCTGAT CAGTAGGTATTACTGCACTTTTACTTTTATTATCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACGGATCGTAATTT AAATACATCCTTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACACTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 49–50 View Figures 49–62 , bears the following eight printed (text in italics handwritten) rectangular labels, seven white: [ BOLIVIA: La Paz Province | San Lorenzo Valley | Rio San Lorenzo 800 m. | 15°48.338’S, 67°29.447’W, 12-19 April 2003 | Brian Harris, coll.], [ON DAMP SOIL | BY RIVER], [ Emesis | cypria ♂ | det. Brian Harris 2003], [DNA sample ID: | NVG-18045H03 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23114H03 | c/o Nick V. Grishin ], [genitalia | NVG240817-21 | Nick V. Grishin ], [USNMENT | {QR Code} | 01466499], and one red [HOLOTYPE ♂ | Emesis (Tenedia) | flecta Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratypes: 3♂♂ and 1♀: Ecuador, Napo Province: 1♂ NVG-18053F07 Santa Inés, R. Haensch S. leg, old, H. Stichel collection No. 3339 [ MFNB]; 1♀ NVG-18045H01, USNMENT 01466497 4 km E Puerto Napo, 500 m, −1.050, −77.783 (could be a mistake and this is the same locality as listed for the next specimen), 6-10- Nov-1988, D. H. Ahrenholz leg. [ USNM] ( Fig. 51–52 View Figures 49–62 ); and 1♂ NVG-18045G12, USNMENT 01466496 14 km E Puerto Napo, 470 m, −1.050, −77.683, 24-Sep-1991, D. H. Ahrenholz leg. [ USNM]; and 1♂ NVG-18045H02, USNMENT 01466498 Peru, Cuzco, Cosñipata Valley, El Mirador, km 68, elevation 1720 m, 25-Oct-2016, S. Kinyon leg. [ USNM].

Type locality. Bolivia: La Paz Province, San Lorenzo Valley, Rio San Lorenzo, elevation 800 m, GPS −15.8056, −67.4908.

Etymology. In Latin, flectus means bent, curved, or bowed. The name, a participle, refers to the orange band and its dark framing along the proximal margin bent near the ventral forewing tornus.

Distribution. Ecuador, Peru, and Bolivia.