Emesis (Tenedia) alisada, Grishin, 2024

Emesis (Tenedia) alisada Grishin, new species

http://zoobank.org/ 8283D573-C2FA-49BA-904B-45010AE37E36

( Fig. 3 View Figure 3 part, 45–48, 107–108)

Definition and diagnosis. Genomic analysis reveals that a pair of specimens ( Fig. 3 View Figure 3 red) initially identified as Emesis (Tenedia) cypria C. Felder and R. Felder, 1861 forms a clade sister to all other E. cypria -like specimens, including Emesis (Tenedia) paphia R. Felder, 1869 , reinstated status (type locality in Mexico: Veracruz), and therefore represents a new species, which in COI barcode differs by 1.7% (11 bp) from E. cypria and by 2.0% (13 bp) from E. paphia . This new species is most similar to and sympatric with Emesis cypria cilix Hewitson, 1870 (type locality in Ecuador: Sarayaku and Mexico), at least in Alluriquin at 700 m (Pichincha, Ecuador), e.g., the specimen NVG-18045G10 we sequenced. Phenotypically, males of the two species differ in the following ways: the discal narrow, wavy dark band on the forewing is not at the right angle towards the costal margin as in E. cypria cilix (the character mentioned in the original description), but is tilted slightly distad at costa, and is offset distad between veins M 3 and CuA 1 (more obvious on the ventral side), and the segment of the band in cell CuA 2 -1A+2A is not offset distad as strongly as in E. cypria cilix . In females, the yellow transverse band does not reach the forewing tornus. In male genitalia ( Fig. 107–108 View Figures 107–132 ), uncus is as long as tegumen, lower valval projection is less robust and stronger turned inward, the upper projection is rounder and broader in ventral view. Due to unexplored phenotypic variation in this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 2063.5.4:A71G, cne 2024.5.4:T75G, cne14049.3.3:A19C, cne14049.3.3:A108G, cne254203.4.6:G58A, and COI barcode: C226T, T364C, T442T, T448C, T457T, C508T, A586A.

Barcode sequence of the holotype. Sample NVG-18045H08, GenBank PQ203557, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAG GTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATT ATAATTGGAGGATTTGGTAATTGATTAGTACCATTAATACTAGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGATTATTACCCCCCTCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTGTACCC CCCACTTTCCTCTAATATTGCCCATGGAGGATCCTCAGTTGATTTAGCTATTTTTTCTTTACACTTAGCAGGTATCTCTTCTATT CTAGGAGCAATTAATTTTATCACCACTATTATCAATATACGAATTAATAACTTATCATTTGATCAAATACCTCTTTTTATTTGAT CAGTAGGTATTACTGCACTTTTACTTTTATTATCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGTAATTT AAATACATCCTTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACACTTATTT

Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 45–46 View Figures 27–48 , bears the following six printed rectangular labels, five white: [ PERU: Piura: 3km SW | Chinchin, 1800m. | 04 42’S 79 49’W | 30 May 2000 | Robbins & Lamas Leg.], [DNA sample ID: | NVG-18045H08 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23114H02 | c/o Nick V. Grishin ], [genitalia | NVG240817-20 | Nick V. Grishin ], [USNMENT | {QR Code} | 01466504], and one red [HOLOTYPE ♂ | Emesis (Tenedia) | alisada Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratype: 1♀ NVG-18095C03 Ecuador: “Slanos” [Los Llanos], old [ MTD] ( Fig. 47–48 View Figures 27–48 ).

Type locality. Peru: Piura Region, 3 km southwest of Chinchin, elevation 1800 m, approx. GPS −4.700, −79.817.

Etymology. In Spanish, alisado means smoothed, flattened, or straightened. The name, treated as a feminine adjective, is given for the lack of the strong kink in the postdiscal band in males at the forewing vein CuA 2.

Distribution. Currently known from the Andes of southern Ecuador and northern Peru.