Emesis (Tenedia) subangularis, Grishin, 2024

Emesis (Tenedia) subangularis Grishin, new species

http://zoobank.org/ 6FB2105E-32C6-4AAB-943F-5A519563E15D

( Fig. 3 View Figure 3 part, 37–42, 103–104)

Definition and diagnosis. Genomic analysis of Emesis (Tenedia) angularis Hewitson, 1870 (type locality in Ecuador, a syntype sequenced as NVG-18038H07) reveals that specimens initially identified as this species and collected to the south of Ecuador are genetically differentiated from the true E. angularis at the species level in the nuclear genome ( Fig. 3 View Figure 3 ) and their COI barcodes are 1.2% (8 bp) different. While the COI barcode difference is not very prominent, the nuclear genomes of the two species differ, and the difference correlates with the wing shape in both sexes. Therefore, we hypothesize that the nuclear genome clade ( Fig. 3 View Figure 3 green), sister to E. angularis ( Fig. 3 View Figure 3 brown), represents a new species. This new species is similar to E. angularis and differs from it by generally less angular hindwing in males, with less developed protrusion in the middle of the outer margin of the hindwing, with less concave margin anteriad and posteriad of it and usually less contrasting submarginal spot in central hindwing cell RS-M 1. The female of the new species possesses a more obtuse hindwing angle at the outer margin but a more prominently hooked forewing apex with a more concave costal margin in the middle and the outer margin by the apex (i.e., more prominently hooked forewing apex). To illustrate the wing shape difference, we show the hindwing or its part for all three males in the type series ( Fig. 37, 41, 42 View Figures 27–48 ) and two males of E. angularis from Ecuador in USNM: NVG-18045B07, USNMENT 01466432 Morona-Santiago, Nueve de Octubre, 1800 m, −2.2167, −78.2167, 10-Sep-1999, R. Robbins, R. Busby, G. Estevez, and A. Aldas leg. ( Fig. 43 View Figures 27–48 ) and NVG-23115A11 Pichincha, Baeza, 2000 m, 28-Sep-1975, S. S. Nicolay leg. ( Fig. 44 View Figures 27–48 , 105–106 View Figures 81–106 ). In male genitalia ( Fig. 103–104 View Figures 81–106 ), the lower and upper valval projections are more parallel to each other, at a smaller angle than in E. angularis ( Fig. 105–106 View Figures 81–106 ), and uncus is convex in the middle, without a small notch. Due to relatively unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne475.6.4:T21C, cne475.6.4:C57A, cne6005.2.1:C180T, cne3598.3.3:A107T, cne7168.1.1:C410G, and COI barcode: A40G, A88G, C361C, T421C, T646C.

Barcode sequence of the holotype. Sample NVG-18045B09, GenBank PQ203556, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTGGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAG GGTCTTTAATCGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCTCCAGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGATTATTACCCCCCTCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTGTACCC CCCACTTTCATCTAATATCGCCCATGGAGGATCATCAGTAGATTTAGCTATTTTTTCCTTACATTTAGCTGGTATCTCCTCTATT TTAGGAGCAATTAATTTTATTACTACTATTATTAACATACGAATTAACAATTTATCATTTGATCAAATACCTCTTTTTATTTGAT CAGTAGGTATTACAGCACTTTTACTTTTATTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGTAATTT AAACACATCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 37–38 View Figures 27–48 , bears the following eight rectangular labels (first three handwritten, others printed), seven white: [ ARGENTINA | Salta, 750m. | Agua Blanca rd. | to Angosta, km.30– 31], [17. VI.1977 | R.C.Eisele], [ Emesis | angularis ♂ | det. Eisele], [DNA sample ID: | NVG-18045B09 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23114H01 | c/o Nick V. Grishin ], [genitalia | NVG240817-18 | Nick V. Grishin ], [USNMENT | {QR Code} | 01466434], and one red [HOLOTYPE ♂ | Emesis (Tenedia) | subangularis Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratypes: 2♂♂ and 1♀: Peru, Cuzco [ USNM]: 1♂ NVG-23115A12 Qda. Morro Leguia, 1950-2150 m, GPS −13.133, −71.550, R. 30-Aug-1989, Robbins leg. ( Fig. 41 View Figures 27–48 , right hindwing outer margin) and 1♀ NVG-18045B08, USNMENT 01466433 Peru: Cuzco, Qbrda Buenos Aires, Cosñipata Rd., 2400 m, 19-Nov-2008, S. Kinyon leg. ( Fig. 39–40 View Figures 27–48 , right side of the specimen) and 1♂ NVG-18052H11 Bolivia (no detailed locality), H. Stichel collection no. 3334 [ MFNB] ( Fig. 42 View Figures 27–48 , right hindwing).

Type locality. Argentina: Salta, west of Aguas Blancas, km 30–31 of the road to El Angosto, elevation 750 m.

Etymology. The name of this new species is formed by adding a prefix sub- to the name of its sister species, given for the less angular shape of the hindwing, and is also made longer for this more southern species, living on the map “below” (i.e., sub-) of E. angularis . The name is a feminine adjective.

Distribution. Currently known from southern Peru, Bolivia, and northern Argentina.

Emesis (Tenedia) paphia R. Felder, 1869 is a species distinct from Emesis (Tenedia) cypria C. Felder and R. Felder, 1861

Genomic analysis reveals that Emesis paphia R. Felder, 1869 (type locality in Mexico: Veracruz), currently regarded as a subspecies of Emesis (Tenedia) cypria C. Felder and R. Felder, 1861 (type locality in Venezuela) ( Callaghan and Lamas 2004), is genetically differentiated from it at the species level ( Fig. 3 View Figure 3 ), e.g., their COI barcodes differ by 2.1% (14 bp). In the presence of recognizable phenotypic differences—e.g., males of E. paphia are darker in ground color and typically have slightly rounder forewings with a broader orange band with more sharply defined and less diffuse edges compared to E. cypria —we propose to treat Emesis (Tenedia) paphia R. Felder, 1869 , reinstated status, as a species-level taxon.