Emesis ( Aphacitis ) andigna, Grishin, 2024
publication ID |
https://doi.org/10.5281/zenodo.14662420 |
publication LSID |
lsid:zoobank.org:pub:EFB3CF5F-6748-41D0-B905-E9CFC8F54D2C |
persistent identifier |
https://treatment.plazi.org/id/03BF8783-FFAC-FFEF-FF23-FAC59995FBDB |
treatment provided by |
Felipe |
scientific name |
Emesis ( Aphacitis ) andigna |
status |
new species |
Emesis ( Aphacitis) andigna Grishin, new species
http://zoobank.org/ DD77E3C7-D040-4B57-9C97-F0FDEABB56AA
( Fig. 5 View Figure 5 part, 73–78, 129–130)
Definition and diagnosis. Genomic analysis of specimens initially identified as Emesis ( Aphacitis) condigna Stichel, 1925 (type locality Brazil: Pará, Santarém, lectotype sequenced as NVG-18053H08) reveals that they partition into two clades genetically differentiated from each other at the species level ( Fig. 5 View Figure 5 brown and cyan), e.g., their COI barcodes differ by 2.3% (15 bp). One clade includes the lectotype of E. condigna , thus representing this species, and the other clade corresponds to a new species. This new species is phenotypically most similar to E. condigna in having a prominent pale spot in the middle near the costal margin of the dorsal hindwing and differs from it by the discal dark dash in the dorsal hindwing cell M 3 -CuA 1 being somewhat offset distad from the line of connected dashes in anterior cells (the dash is aligned with others in the lectotype of E. condigna ), and generally paler ventral side of wings, which is more heavily marked with dark framing, bands, and dashes in E. condigna . Additionally, it differs from closely related Emesis ( Aphacitis) castigata Stichel, 1910 ( Peru: Pozuzo, lectotype sequenced as NVG-18053H07) by darker forewing apical area beneath, including the apex itself, which is more orange in E. castigata , and possesses a better-defined pale spot in the middle of the costal area of dorsal hindwing. In male genitalia ( Fig. 129–130 View Figures 107–132 ), falces are narrower, cornutus is more robust; in ventral view, the lower valval projection is narrower at the base and the upper projection is less rounded, more square-shaped. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne6600.5.10:T61C, cne16584.1.1:T63C, cne16584.1.1:G93C, cne50888.1.8:A36G, cne50888.1.8:A63T, and COI barcode: 250T, 358T, G482A, T581C, T634C.
Barcode sequence of the holotype. Sample NVG-18044B12, GenBank PQ203569, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTCGGTACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAG GTTCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGTGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGACTTTTACCCCCCTCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCTAATATTGCCCATGGAGGAGCTTCAGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATT TTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGTATTAATAATTTAACATTTGATCAAATACCATTATTTGTTTGAT CTGTTGGAATTACAGCTCTTTTACTTTTATTATCTCTTCCAGTTTTAGCAGGAGCTATTACTATATTACTAACAGATCGTAATTT AAATACATCATTTTTTGACCCTGCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 73–74 View Figures 71–80 , bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PERU: Cuzco 540 m. | Villa Carmen | Pilcopata 4264 | 29-IV-2015 Kinyon], [DNA sample ID: | NVG-18044B12 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23114H11 | c/o Nick V. Grishin ], [genitalia | NVG240817-30 | Nick V. Grishin ], [USNMENT | {QR Code} | 01466346], and one red [ HOLOTYPE ♂ | Emesis (Aphacitis) | andigna Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratypes: 2♂♂ from Peru: NVG-18052G01 Monte Alegre, Rio Pachitea, old, G. Tessmann leg. [ MFNB] ( Fig. 75–76 View Figures 71–80 ) and NVG-18039E12 Puerto Maldonado, forest across Tambopata River from Explorer’s Inn Nature Reserve, 900’, 28-Aug-1985, J. Mix collection No. 13921 [ FMNH] ( Fig. 77–78 View Figures 71–80 ).
Type locality. Peru: Cuzco, Villa Carmen, Pilcopata, elevation 540 m.
Etymology. A species from or near the Andes, closely related to E. condigna (means deserved, appropriate in Latin): And [es] + [cond] igna. The name is treated as a feminine adjective.
Distribution. Currently known only from Peru.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |