Emesis (Aphacitis) luxata, Grishin, 2024

Emesis (Aphacitis) luxata Grishin, new species

http://zoobank.org/ F4979856-9A3D-46CC-A772-2DBD9A72D87C

( Fig. 5 View Figure 5 part, 79–80, 131–132)

Definition and diagnosis. Genomic analysis of a specimen from Southeast Brazil ( Fig. 5 View Figure 5 orange) that was identified in the collection as Emesis (Aphacitis) fastidiosa Ménétriés, 1855 (type locality in Brazil), probably due to locality, reveals that it is not closely related to this species and instead is sister to both Emesis (Aphacitis) condigna Stichel, 1925 (type locality Brazil: Para, Santarem, lectotype sequenced as NVG-18053H08) and Emesis (Aphacitis) andigna , new species (type locality in Peru: Cuzco), thus representing a new species due to that and genetic differentiation from others, e.g., its COI barcode differs by 1.2% (8 bp, low probably due to introgression) from E. condigna and by 2.6% (17 bp) from E. andigna . This new species is phenotypically most similar to E. condigna , E. andigna , and Emesis (Aphacitis) opaca Stichel, 1910 (type locality in French Guiana) and differs from them and other in the subgenus Aphacitis Hübner, [1819] by a combination of the following characters: dorsal hindwing with a weakly defined pale spot in the middle near the costal margin (absent in E. opaca ), the discal dark dash in cell M 3 -CuA 1 on dorsal hindwing that is strongly offset distad, as in Emesis (Aphacitis) fastidiosa Ménétriés, 1855 (type locality in Brazil) (the dash is mostly aligned with the anterior part of the discal band in E. condigna and weakly offset in E. andigna ), more washed-out less distinct dark dashes on dorsal side, apex of forewing with significant dark overscaling beneath, not mostly orange as in Emesis (Aphacitis) castigata Stichel, 1910 ( Peru: Pozuzo, lectotype sequenced as NVG-18053H07). Males of the new species differ from the sympatric E. fastidiosa by rounder forewing outer margin, less produced forewing apex darker on both sides, smaller and sharper defined submarginal inverted lunules on ventral hindwing, and a discal bar in cell Sc+R 1 -RS nearly aligned with the bar in cell RS-M 1 (the latter is offset distad from the former in E. fastidiosa ). In male genitalia ( Fig. 131–132 View Figures 107–132 ), the lower and upper valval projections are smaller and weaker separated from each other, rounded, knob-like. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne5787.2.15:G27C, cne11414.2.6:A69G, cne11414.2.6:T18C, cne4293.8.1:A13C, cne4293.8.1:A22T, cne 2256.1.1:A1045A (not T), cne3201.5.1:A64A (not G), cne3201.5.1:C66C (not T), cne43189.1.2:G462G (not A), cne939.13.9:C182C (not T), and COI barcode: T181C, G200A, T463C, T542C, A586G.

Barcode sequence of the holotype. Sample NVG-18053F06, GenBank PQ203570, 658 base pairs: AACCTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGTACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAG GTTCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGCGGATTTGGTAATTGATTAATCCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAACATAAGAT TTTGACTTTTACCCCCCTCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCTAACATTGCCCATGGAGGAGCTTCAGTTGATTTAGCTATTTTTTCTCTCCATTTAGCTGGAATTTCATCTATT TTAGGAGCAATTAATTTTATTACTACAATCATTAACATACGTATTAATAATTTAGCATTTGATCAAATACCATTATTTGTTTGAT CTGTTGGAATTACAGCTCTTTTACTTTTACTATCTCTTCCAGTTTTAGCGGGAGCTATTACTATATTATTAACGGATCGTAATTT AAATACATCATTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ currently deposited in the Museum für Naturkunde , Berlin, Germany ( MFNB), illustrated in Fig. 79–80 View Figures 71–80 , bears the following four rectangular labels (1 st green, last red and others white; 2 nd handwritten, others printed): [ Brazil, Sao Paulo | Aracatuba | Oct. 1935 | ex coll. Arnold Schultze], [Aracatuba | Oct-35 | Aze] (the last line is illegible and appears to be a short signature), [DNA sample ID: | NVG-18053F06 | c/o Nick V. Grishin ], and [HOLOTYPE ♂ | Emesis (Aphacitis) | luxata Grishin] . Paratype: 1♂ NVG-23114H12 Brazil: São Paulo, 17 km W of Teodoro Sampaio, 600 m, GPS −22.517, −52.200 ( GPS does not exactly correspond to the stated locality), 16-Mar-1991, R. Robbins, O. Mielke, and M. Casagrande leg., genitalia vial NVG240817-31 ( Fig. 131–132 View Figures 107–132 ) [ USNM].

Type locality. Brazil: São Paulo, Araçatuba.

Etymology. In Latin, luxatus means dislocated and is given for the central spot in the hindwing discal band strongly offset distad in this species. Also, lux is Latin for light, fitting this brightly colored species. The name is a participle.

Distribution. Currently known only from Southeast Brazil.