Merodon bicolor, GIL COLLADO, 1930
publication ID |
https://doi.org/10.1111/j.1096-3642.2008.00462.x |
persistent identifier |
https://treatment.plazi.org/id/03C4BE00-A066-FFC7-FC93-F94AD359FA66 |
treatment provided by |
Felipe |
scientific name |
Merodon bicolor |
status |
comb. nov. |
MERODON BICOLOR GIL COLLADO, 1930 View in CoL COMB. NOV.
Merodon spinipes bicolor Gil Collado, 1930: 254 View in CoL
Based on morphology ( Marcos-García et al., 2007), M. avidus View in CoL from Spain ( Marcos-García, 1985, 1990)
22222222222222222222222222222222222222222222222222222 22233333344444444444555555566666666677777778888888999 55914468901133555789001345800022455912456790023779569 36590612162537147280257249347828928554579862865173248 Population Haplotype * * * * * VM567 AMOR, June I TATATCCTTTTAATCTTTGTACATTCCTATTTTCTCCCCCAATTTTCTCTTGC VM581 AMOR, August II ................................C....T...G.....C..... VM596* AMOR, August III.G..............................C....T.-------------- VM615 ADUB, September IV .....................................T..G......C...A. VM590 BDUR IV .....................................T..G......C...A. VM 823 M. avidus, Lesvos IV .....................................T..G......C...A. VM560 BMAV V .....................................T..GG.....C..... VM572* BMAV IV/V .....................................T.-------------- VM578* APIN, May IV/V .....................................T.-------------- VM591* BPIN, July IV/V .....................................T.-------------- VM 824 M. avidus A, Lesvos VI ...................................................A. VM561 APIN, May VII ................................C....T.........C..... VM616 ADUB, September VII ................................C....T.........C..... VM571 BDUB, August VII ................................C....T.........C....- VM557 BDUB, June VIII ................................C....T..............- S 409 M. avidus A, Lesvos VIII ................................C....T............... VM589 BDUR, June IX ..................A..................T..G......C..... VM605 BDUR, June X .......................CC............T..G......C..... VM563 BPIN, July XI .....................................T..G......CT.... VM566 AMOR, June XII ......T............C.T...............T.....C..TC.C.A. VM558 BDUB, June XIII ................................C....T.........C..... VM583 BDUB, July XIV .....................................T..G......C....- VM579 AMOR, April XIV .....................................T..G......C..... S 524 M. avidus B, France XV .....................................T.........C...A. VM580 AMOR, April XVI ................................C.C..T.........C..... S 532 M. avidus A, Lesvos XVII C.C.......C......C.C......T..........T.....CC..C.C.A. X14** M. bicolor , Spain XVIII ..CTCCTCCC.GCCTAA...TTT.CTTC.CCCCTCTTTTTCTCCCCTC.CCAT VM 826 M. bicolor, Spain XIX ..CTCCTCCC.GCCTAA...TTT.CTTC.CCCCT.TTTTTCTCCCCTC.CCAT VM 827 M. bicolour, Spain XX ..CTCCTCCC GCCTAA...TTT.CTTCGCCCCTCTTTTTCTCCCCTC.CCAT was initially identified as M. avidus B sensu Milankov et al. (2001) ( Mengual et al., 2006; Marcos-García et al., 2007).
We propose the name M. bicolor Gil Collado, 1930: 254 ( Merodon , as var. of spinipes ) (identity: valid species: comb. nov.) for the cryptic taxon from the Iberian Peninsula. Merodon bicolor was described from the three syntypes ( Gil Collado, 1930), as a variety of M. spinipes (Fabricius) from following localities: El Escorial, Cazzurro, Cercedilla, Arias, Somosiera, G. Menor. In depositary museum (Instituto Español de Entomología, Madrid, Spain), only one syntype was found. Based on this type specimen, the lectotype of this taxon was designated here: male ‘s pinipes v. bicolor / Cazurro’ (El Escorial, Spain) (MNCN). The lectotype shared the morphological characters with specimens from Spain analysed in this paper ( Tables 1, 2).
Wing size (F (2,498) = 65.57, P <0.001) and shape (Wilks’ L = 0.49; F (32,966) = 12.75; P <0.000) of two the available specimens from Spain were distinctly different from both M. avidus A and M. avidus B from the Balkan Peninsula. COI mtDNA sequence divergences between the Balkan and Spanish clades ranged from 4.93 to 6.0 ( Table 4). Thus, wing morphometrics and COI mtDNA haplotypes allowed clear delineation of these cryptic taxa.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.