Eresus granosus Simon, 1895

Lee, Sue Yeon, Jang, Chang Moon, Yoo, Jung Sun, Jo, Yeong-Seok & Kim, Seung Tae, 2025, Revision of the velvet spiders (Araneae, Eresidae) with a new record from South Korea, Biodiversity Data Journal 13, pp. e 165869-e 165869 : e165869-

publication ID	https://doi.org/10.3897/BDJ.13.e165869
DOI	https://doi.org/10.5281/zenodo.16939975
persistent identifier	https://treatment.plazi.org/id/0DF3D7A1-997F-5D2C-85FB-55BA024DEBF5
treatment provided by	Biodiversity Data Journal by Pensoft
scientific name	Eresus granosus Simon, 1895
status

Treatment

Eresus granosus Simon, 1895 View in CoL

Materials

Type status: Other material. Occurrence: catalogNumber: TTQXIV 0000000229 ; recordedBy: Sue Yeon Lee, Chang Moon Jang & Seung Tae Kim; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 4886E523-BF7B-5D46-A662-2807D51EFD0C; Taxon: scientificName: Eresus granosus ; kingdom: Animalia; phylum: Arthropoda; class: Arachnida; order: Araneae ; family: Eresidae ; Location: country: South Korea; stateProvince: Chungcheongbuk-do; municipality: Taean-gun; locality: Sindu-ri, Wonbuk-myeon ; verbatimElevation: 37 m; verbatimCoordinates: 36°50'36.7"N 126°11'51.6"E; Identification: identifiedBy: Seung Tae Kim; Event: samplingProtocol: hand collecting; eventDate: 23-05-2024; habitat: coastal sand dune; Record Level: institutionCode: National Institute of Biological resources ( NIBR) GoogleMaps

Type status: Other material. Occurrence: catalogNumber: KKU-Ere- 20240623-01 ; recordedBy: Sue Yeon Lee, Chang Moon Jang & Seung Tae Kim; individualCount: 2; sex: male; lifeStage: adult; occurrenceID: 170EF2F0-268E-5B63-832A-F6956C2097F2; Taxon: scientificName: Eresus granosus ; kingdom: Animalia; phylum: Arthropoda; class: Arachnida; order: Araneae ; family: Eresidae ; Location: country: South Korea; stateProvince: Chungcheongbuk-do; municipality: Taean-gun; locality: Sindu-ri, Wonbuk-myeon ; verbatimElevation: 37 m; verbatimCoordinates: 36°50'36.7"N 126°11'51.6"E; Identification: identifiedBy: Seung Tae Kim; Event: samplingProtocol: hand collecting; eventDate: 23-05-2024; habitat: coastal sand dune; Record Level: institutionCode: Konkuk University ( KKU) GoogleMaps

Type status: Other material. Occurrence: catalogNumber: TTQXIV 0000000230 ; recordedBy: Sue Yeon Lee, Chang Moon Jang & Seung Tae Kim; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 4822F3C9-334E-5029-AD0F-0AEDF0014170; Taxon: scientificName: Eresus granosus ; kingdom: Animalia; phylum: Arthropoda; class: Arachnida; order: Araneae ; family: Eresidae ; Location: country: South Korea; stateProvince: Chungcheongbuk-do; municipality: Taean-gun; locality: Sindu-ri, Wonbuk-myeon ; verbatimElevation: 37 m; verbatimCoordinates: 36°50'36.7"N 126°11'51.6"E; Identification: identifiedBy: Seung Tae Kim; Event: samplingProtocol: hand collecting; eventDate: 23-05-2024; habitat: coastal sand dune; Record Level: institutionCode: National Institute of Biological resources ( NIBR) GoogleMaps

Type status: Other material. Occurrence: catalogNumber: KKU-Ere- 20240623-02 ; recordedBy: Sue Yeon Lee, Chang Moon Jang & Seung Tae Kim; individualCount: 2; sex: female; lifeStage: adult; occurrenceID: 4297BD0A-582A-54EF-9127-2B6A2978AC8C; Taxon: scientificName: Eresus granosus ; kingdom: Animalia; phylum: Arthropoda; class: Arachnida; order: Araneae ; family: Eresidae ; Location: country: South Korea; stateProvince: Chungcheongbuk-do; municipality: Taean-gun; locality: Sindu-ri, Wonbuk-myeon ; verbatimElevation: 37 m; verbatimCoordinates: 36°50'36.7"N 126°11'51.6"E; Identification: identifiedBy: Seung Tae Kim; Event: samplingProtocol: hand collecting; eventDate: 23-05-2024; habitat: coastal sand dune; Record Level: institutionCode: Konkuk University ( KKU) GoogleMaps

Description

Male. Habitus as in Fig. 3 View Figure 3 A – C. Total length 9.91. Carapace: 5.46 long / 3.62 wide / 2.94 high. Eyes: AER 0.84, PER 2.98. Endite: 1.36 long / 0.81 wide. Labium: 1.04 long / 0.73 wide. Sternum: 2.74 long / 1.71 wide. Legs: I 11.24 (3.62, 1.65, 1.97, 2.11, 1.89), II 9.78 (3.06, 1.56, 1.62, 1.88, 1.66), III 8.72 (2.95, 1.57, 1.27, 1.64, 1.29), IV 11.36 (3.63, 1.90, 2.08, 2.17, 1.59). Palp: 3.42 (1.39, 0.60, 0.28, -, 1.15). Abdomen: 5.37 long / 4.58 wide.

Carapace black, rectangular, longer than wide; head region elevated, covered densely with black setae; thoracic region covered with black and white setae, orange setae lined along the margin; AER <PER (Fig. 3 View Figure 3 A and C). Chelicerae stout, black, covered with black setae (Fig. 3 View Figure 3 A – C). Endite black, slightly curved, anterior edge blunt (Fig. 3 View Figure 3 B). Sternum nearly black, narrow, much longer than wide, covered densely with black and white setae, anterior edge truncated (Fig. 3 View Figure 3 B). Legs thick and strongly developed, covered densely with black, white and orange setae; mostly black, with femur II and femur and patella III, IV orange; joints with white annuli; leg formula IV-I-II-III (Fig. 3 View Figure 3 A – C). Abdomen orange, with four or six black, round spots, anterior part protruding above the thoracic region (Fig. 3 View Figure 3 A and C). Palpus (Fig. 3 View Figure 3 I – K): tegulum round; embolus rotating clockwise along the top of the tegulum; conductor sclerotised, wider than long, with a prominent shoulder; terminal tooth sclerotised, slightly incurvated towards groove; groove U-shaped; lamella translucent with a feather-like edge, subequal with a terminal tooth in length.

Female. Habitus as in Fig. 3 View Figure 3 D – F. Total length 16.43. Carapace: 9.14 long / 6.25 wide / 3.83. Eyes: AER 1.07, PER 4.05. Endite: 2.12 long / 1.31 wide. Labium: 1.54 long / 1.10 wide. Sternum: 4.49 long / 2.23 wide. Legs: I 15.07 (4.91, 2.59, 2.55, 2.68, 2.34), II 13.39 (4.32, 2.53, 2.07, 2.48, 1.99), III 11.71 (4.19, 2.36, 1.82, 1.92, 1.42), IV 16.10 (5.63, 2.86, 3.05, 2.72, 1.84). Palp: 6.23 (2.25, 1.27, 0.88, -, 1.83). Abdomen: 10.40 long / 8.40 wide. Epigynum: 1.24 wide.

Carapace dark reddish-black, rectangular, longer than wide, covered densely with black setae; head region elevated; AER <PER (Fig. 3 View Figure 3 D and F). Chelicerae stout, reddish-black, covered with black setae (Fig. 3 View Figure 3 D – F). Endite reddish-black, straight, anterior edge angular, truncated (Fig. 3 View Figure 3 E). Sternum reddish-brown mottled with black, narrow, much longer than wide, anterior edge truncated, covered densely with black setae (Fig. 3 View Figure 3 E). Legs thick and strongly developed, covered densely with black setae; blackish-brown, dorsum with one or two reddish-brown streaks; leg formula IV-I-II-III (Fig. 3 View Figure 3 D – F). Abdomen uniformly black, with three pairs of muscle impressions, dorsum flat, anterior part protruding above the thoracic region (Fig. 3 View Figure 3 D and F). Epigyne (Fig. 3 View Figure 3 G): elliptical with a sclerotised margin, anterior bar wide, slightly depressed, wider than long, fissure anteriorly incurvated, slightly towards the centre. Internal genitalia (Fig. 3 View Figure 3 H): copulatory ducts large, translucent, contiguous, anterior section circular; spermathecae very distinctly lobated, reaching further laterally than copulatory ducts.

Habitat

This species is found to inhabit the western coastal sand dunes in South Korea (Fig. 1 View Figure 1 A). The spider builds a silken tunnel, about 15–20 cm in length, underground in the sandy soil between coastal plants, such as strand sedges ( Carex pumila Thunb. ) ( Cyperaceae ) (Fig. 1 View Figure 1 B). A sheet web is attached above the entrance of the silken tube, which is connected to the ground (Fig. 1 View Figure 1 C). Sometimes, the exoskeletons of beetles, such as Carabidae and Tenebrionidae spp. ( Insecta, Coleoptera ), which have been preyed upon by the spider, can be found attached to the entrance (Fig. 1 View Figure 1 E).

Distribution

Russia (West Siberia), China, South Korea (new record) (World Spider Catalog 2025).

DNA Barcodes

TA 1

AAAATCAAAATAAATGCTGAAATAAAATAGGATCTCCTCCCCCAGCAGGATCAAAAAACGATGTATTAAAATTTCGATCAGTTAATAATATTGTAATAGCACCCGCTAAAACAGGTAAAGATAATAATAATAATACCGCAGTAATTAAAACAGATCAAACAAATAATGGTACCTTCTCTATAGTTATTCCATATGAACGTATATTAAGTACAGTAGTAATAAAATTAATAGCCCCCATAATAGAAGAAGCCCCAGCTAAATGTAATGAAAAAATGGCAAAATCTACTGATCTCCCCGCATGACCCATTAATGAGGCTAAAGGAGGGTAAACAGTTCACCCTGTCCCTACACCCATTTCTACTATAGAAGATATAAATAATATAAACAATGAAGGAGGCAATAACCAAAAACTCAAATTATTTATTCGAGGAAAAGCTATATCAGGTGCTCCTAATATTAAAGGAACCAATCAATTCCCAAACCCACCAATTATAATTGGTATAACTATAAAAAAAATTATCACAAAAGCATGAGCAGTAACAACAACATTATACAAATGATCATCTCCTAATAATCTCCCAGATTGTCCTAATTCTGTTCGAATAATTATTCTTATTGAAGTTCCAACTATAGCTGATCAAGCTCCAAAAATTAAATACAATGTTCCAA (GenBank accession number PV 785319)

TA 2

AAAATCAAAATAAATGCTGAAATAAAATAGGATCTCCTCCCCCAGCAGGATCAAAAAACGATGTATTAAAATTTCGATCAGTTAATAATATTGTAATAGCACCCGCTAAAACAGGTAAAGATAATAATAATAATACCGCAGTAATTAAAATAGATCAAACAAATAATGGTACCTTCTCTATAGTTATTCCATATGAACGTATATTAAGTACAGTAGTAATAAAATTAATAGCCCCCATAACAGAAGAAGCCCCAGCTAAATGTAATGAAAAAATGGCAAAATCTACTGATCTCCCCGCATGACCTATTAATGAGGCTAAAGGAGGGTAAACAGTTCACCCTGTCCCTACACCCATTTCTACTATAGAAGATATAAATAATATAAACAATGAAGGAGGCAATAACCAAAAACTCAAATTATTTATTCGAGGAAAAGCTATATCAGGTGCTCCTAATATTAAAGGAACCAATCAATTCCCAAACCCACCAATTATAATTGGTATAACTATAAAAAAAATTATCACAAAAGCATGAGCAGTAACAACAACATTATACAAATGATCATCTCCTAATAATCTCCCAGATTGTCCTAATTCTGTTCGAATAATTATTCTTATTGAAGTCCCAACTATAGCTGATCAAGCTCCAAAAATTAAATACAATGTTCCAA (GenBank accession number PV 785320)

TA 4

AAAATCAAAATAAATGCTGAAATAAAATAGGATCTCCTCCCCCAGCAGGATCAAAAAACGATGTATTAAAATTTCGATCAGTTAATAATATTGTAATAGCACCCGCTAAAACAGGTAAAGATAATAATAATAATACCGCAGTAATTAAAATAGATCAAACAAATAATGGTACCTTCTCTATAGTTATTCCATATGAACGTATATTAAGTACAGTAGTAATAAAATTAATAGCCCCCATAACAGAAGAAGCCCCAGCTAAATGTAATGAAAAAATGGCAAAATCTACTGATCTCCCCGCATGACCTATTAATGAGGCTAAAGGAGGGTAAACAGTTCACCCTGTCCCTACACCCATTTCTACTATAGAAGATATAAATAATATAAACAATGAAGGAGGCAATAACCAAAAACTCAAATTATTTATTCGAGGAAAAGCTATATCAGGTGCTCCTAATATTAAAGGAACCAATCAATTCCCAAACCCACCAATTATAATTGGTATAACTATAAAAAAAATTATCACAAAAGCATGAGCAGTAACAACAACATTATACAAATGATCATCTCCTAATAATCTCCCAGATTGTCCTAATTCTGTTCGAATAATTATTCTTATTGAAGTCCCAACTATAGCTGATCAAGCTCCAAAAATTAAATACAATGTTCCAA (GenBank accession number PV 785321)

TA 5

TA 6

AAAATCAAAATAAATGCTGAAATAAAATAGGATCTCCTCCCCCAGCAGGATCAAAAAACGATGTATTAAAATTTCGATCAGTTAATAATATTGTAATAGCACCCGCTAAAACAGGTAAAGATAATAATAATAATACCGCAGTAATTAAAATAGATCAAACAAATAATGGTACCTTCTCTATAGTTATTCCATATGAACGTATATTAAGTACAGTAGTAATAAAATTAATAGCCCCCATAACAGAAGAAGCCCCAGCTAAATGTAATGAAAAAATGGCAAAATCTACTGATCTCCCCGCATGACCTATTAATGAGGCTAAAGGAGGGTAAACAGTTCACCCTGTCCCTACACCCATTTCTACTATAGAAGATATAAATAATATAAACAATGAAGGAGGCAATAACCAAAAACTCAAATTATTTATTCGAGGAAAAGCTATATCAGGTGCTCCTAATATTAAAGGAACCAATCAATTCCCAAACCCACCAATTATAATTGGTATAACTATAAAAAAAATTATCACAAAAGCATGAGCAGTAACAACAACATTATACAAATGATCATCTCCTAATAATCTCCCAGATTGTCCTAATTCTGTTCGAATAATTATTCTTATTGAAGTCCCAACTATAGCTGATCAAGCTCCAAAAATTAAATACAATGTTCCAA (GenBank accession number PV 785323)