Moostea stephanieae Tedersoo, 2024
publication ID |
https://doi.org/10.3897/mycokeys.107.125549 |
DOI |
https://doi.org/10.5281/zenodo.13286538 |
persistent identifier |
https://treatment.plazi.org/id/0EF302DD-BD47-544E-A9A2-605C87529DC0 |
treatment provided by |
|
scientific name |
Moostea stephanieae Tedersoo |
status |
sp. nov. |
Moostea stephanieae Tedersoo sp. nov.
Diagnosis.
Separation from other species of Moostea based on the ITS region (positions 68–97 gcagatgatcgtgagggagttctcttcttc; one mismatch allowed) and LSU (positions 436–455 tgggcttctgctccggcgta; one mismatch allowed) as indicated in Fig. 11 View Figure 11 .
Type.
Soil eDNA sample TUE 128417 ( holotype); eDNA sequence EUK 1604044 ( lectotype); GSMc plot G 5828, Malus domestica orchard (soil sample TUE 028417 ) in Mooste , Estonia, 58.15335 ° N, 27.19642 ° E GoogleMaps .
Description.
Other sequences: EUK 1600287 (LSU: type locality); EUK 1604043 and EUK 1603823 (both GSMc plot G 5835, airfield soil in Ridali, Estonia, 57.93692 ° N, 26.98099 ° E).
Etymology.
Mooste (Estonian) refers to type locality; and Stephanie (English) refers to the first name of Stephanie A. Eichorst who collected the first materials from the respective family.
Notes.
Found in two sites in Estonia, with ITS and LSU sequences displaying up to 1 % and 0.3 % differences, respectively.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |