Kuwayamachrysa neptuna, Wang & Lai & Liu, 2025

Kuwayamachrysa neptuna sp. nov.

( Figs 5 View FIGURE 5 , 6 View FIGURE 6 )

Diagnosis. Forewing veins mostly brown, but longitudinal veins pale; hind wing pale. Abdomen scarlet ventrally, scarlet markings present on terga.

Description. Body. Mostly green, 12.70-15.10 mm long ( Fig. 5A, B, E View FIGURE 5 ).

Head. 1.50-1.70 mm wide (including compound eyes). Green, with genal markings and lateral markings, and with irregular markings on frons between scape (sometimes absent). Mandibles asymmetrical, broad; labial and maxillary palpi yellow, brownish on palpomeres 1-2, slightly tapered apically. Antenna shorter than forewing, brownish; scape and pedicel greenish, unmarked, flagellar setae arranged in four rings, flagellum yellowish, setae brownish ( Fig. 5B, C, D View FIGURE 5 ).

Thorax. Greenish, pronotum as long as wide; setae dark, with brown, broad stripes present on pronotum laterally, two brown markings present on prescutum of metanotum; transverse sulci present. A yellowish longitudinal median stripe, present on pro-, meso-, and metanotum ( Fig. 5A, B, E View FIGURE 5 ).

Legs. Greenish, unmarked, covered with short black setae; claws curved, brown.

Forewing. 14.60 mm long. Wing membrane transparent, rounded apically, tegula unmarked; longitudinal veins mostly greenish, costal crossveins marked brown or brownish basally, greenish distally, psm-psc crossveins brownish or 1-5 psc-psm crossveins greenish, base of anal veins greenish or marked brown, other veins marked brown. Costal crossveins simple, straight, slightly sinuous on third and fourth crossveins, 22 costal crossveins present; basal subcostal crossvein present, crossveins posteriad pterostigma absent; 13 radial crossveins present; intramedian cell (im) triangular, subdistally connected by 1rp-m crossvein; three gradate series of crossveins present in most individuals but two present occasionally, number of gradates (inner/middle/outer: 7/2/7); basal crossveins of first gradate series not meeting PsM; dcc open, CuP not forked ( Fig. 5A, E View FIGURE 5 ).

Hind wing. Pterostigma greenish, veins greenish; 17 costal crossveins present; two gradate series of crossveins, number of gradates (inner/outer): 6/5 ( Fig. 5A, E View FIGURE 5 ).

Abdomen. Greenish; red longitudinal stripe present on sterna 2-7, and sterna covered with short black setae; red stripes and markings present on terga; spiracles small, round, not enlarged, atria not enlarged ( Fig. 5A, E View FIGURE 5 ).

Male genitalia. Tergum 9 and ectoprocts fused; ectoproct rounded; dorsal invagination shallow; thick setae on ectoproct absent; sterna 8 and 9 fused, regular, without strong apical setae; gonarcus medially fused, lateral arm expanded; entoprocessus robust, slightly curved, bifurcated and slightly expanded; mediuncus closely associated with gonarcus, slender, laterally expanded, mediuncus process absent; gonosaccus robust, with gonosetae and spinellae; parameres absent; numerous gonostae present; gonapsis constituted by a pair of asymmetrical pieces: flat on one side, tapered on the other, slightly curved; tignum absent ( Fig. 6A, C, D, E, F View FIGURE 6 ).

Female genitalia. Tergum 9 and ectoprocts fused; sternum 7 simple, apically rounded; subgenitale broader than long, attached to a broad membranous structure; spermatheca round; vela thick and elongate; spermatheca twisted ( Fig. 6B, G, H View FIGURE 6 ).

Type material. Holotype ♂, CHINA, Henan: Luoyang, Mt. Baiyunshan (白云山), Xiaohuangshan (小#山), 33.6840°N, 111.8391°E, 1600 m, 11.VII.2020, Weihai Li, Yanhua Yan ( CAU) GoogleMaps . Paratypes: CHINA, Henan: 3♀, Luoyang, Mt. Baiyunshan (白云山), 33.6822°N, 111.8436°E, 1500 m, 10.VII.2020, Wenliang Li ( CAU); GoogleMaps Shaanxi: 2♂, Zhouzhi, Houzhenzi (ñḃŦ), Laoxiancheng (Ɩ县µ), 107.7596°E. 33.7933°N, 1777 m, 14.VII.2018 (L), Yingnan He ( CAU) GoogleMaps ; 2♂, Foping, Daguping (k古坪), 33.5945°N, 107.7677°E, 1329.2 m, 24.VII.2014 (L), Xiumei Lu ( CAU) GoogleMaps ; 3♀, Nanzheng, Liping (NJ坪), 106.6509°E, 32.8024°N, 1554 m, 3.VII.2018 (L), Yingnan He ( CAU) GoogleMaps ; Sichuan: 1♀, Muli, Wujiao (屋¶), 27.9624°N, 100.7473°E, 2823 m, 24.VII.2020 (L), Yuezheng Tu ( CAU) GoogleMaps .

Etymology. The specific name neptuna is derived from the Latin name Neptunus, the god of sea, using trident as weapon, referring to the trifurcated frontal marking of the new species.

Distribution. China (Sichuan, Henan, Shaanxi).

Remarks. Although the specimens of K. neptuna we examined show significant variation, such as the markings on the frons and the coloration of the forewing veins, the new species can be distinguished by its greenish hind wing veins, a smaller gonapsis, and mediuncus noticeably more slender than that of other species of Kuwayamachrysa . Therefore, combining morphological characteristics and molecular evidence ( Fig. 7 View FIGURE 7 ), we propose K. neptuna as a new species with variable characteristics, and we suggest that it is the species that Lai et al. (2024) referred to as Kuwayamachrysa sp. 1 YLBOLD.

DNA barcode sequence

TCGCGACAGTGATTATTTTCAACTAACCATAAAGATATTGGTACATTATATTTTATTTTTGGAATTTGATC TCTGGATTAGTAGGTACTAGTTTAAGATTATTAATTCGAGCTGAATTAGGTCTCTGGATTAGTAGGTAAA CCAGGTTCATTAATTGGTGATGATCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTT TTTATAGTTATACCTATTGTAATTGGAGGATTTGGTAATTGATTAGTTCGGAACAGGTTGAACTGTCTAT CACCCCTTTCTTCTAGAATTGCCCATGCAGGAGCTTCTGTTGATTTAGCTATTTTTAGTTTACATTTAGC TGGAATTTCATCAATTTTAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGTTTAAGATACATAA CTTTAGATCGAATACCCTTATTTGTTTGATCAGTTGTTATTACAGCATTACTTCTTCTATTATCTTTACCTG TATTAGCAGGAGCTATCACTATATTATTAACAGATCGTAATTTAAATACTTCTTTTTTTGATCCCGCAGGA GG AGGAGATCCAATTTTATACCAACATTTATTTTGA