Leptopilina clavipes (Hartig, 1841)

Leptopilina clavipes (Hartig, 1841)

Cothonaspis clavipes Hartig, 1841: 357 .

Diagnosis.

Leptopilina clavipes is a size-variable species with relatively short appendages (Fig. 4 A View Figure 4 ).

The species has a unique mesoscutellum which is not subdivided into a dorsal and posterior surface by a circumscutellar carina or varying sculpture dorsally and posteriorly (Fig. 4 E View Figure 4 ). In other species, there is a more or less clear division by the circumscutellar carina and different sculpture dorsally and posteriorly.

The mesoscutum has rows of setae mediolaterally, just as in the smaller L. australis (Fig. 11 A View Figure 11 , susceptible to damage). None of the other species exhibit these rows of setae.

The metapleural ridge 1 reaches to about half the length of the metapleuron (Fig. 4 D View Figure 4 ), as in L. longipes . The other species either possess a longer ridge 1 ( L. japonica and L. heterotoma ), a shorter ( L. australis and L. fimbriata ), or an absent one ( L. boulardi ).

The metapleural ridge 2 is shorter than half the length of the metapleuron (Fig. 4 D View Figure 4 ) as in L. australis , L. boulardi and L. fimbriata . In all other species, ridge 2 is at least half the length of the metapleuron.

Molecular characterisation.

Maximum intraspecific barcode-distance: - % (1).

Minimum interspecific barcode-distance: 14.3 % ( L. longipes ).

CO 1 barcode sequence: 658 bp.

5 ’ - TTTAATATATTTTATATTTGGAATTTGGTCAGGGATAGTAGGAGCAAGATTAAGAATAATTATTCGATTAGAGTTAGGAACTCCTGGGCAGTTAATTAATAATGACCAGATTTATAATTCTATAGTGACTGTTCATGCTTTTGTTATAATTTTTTTTATAGTTATGCCTATTATAGTAGGAGGATTTGGTAATTATTTAGTTCCTTTAATAGTTACAGTTCCTGATATGGCTTTTCCTCGTTTAAATAATATGAGATTATGACTTTTATTTCCTTCTTTAATTTTAATGTTAGCTAGTATATTTATTGATCAAGGAGCAGGAACTGGGTGAACTGTGTATCCTCCTCTTTCTTTAAGTGTAAGGCATCCTGGAGTAGCTGTAGATTTAATTATTTTTTCTTTACATTTAAGAGGGGTTTCATCAATTTTAGGGTCTATTAATTTTATTTCTACAATTTTTAATATTCGTCCATTGTTAATAGGGATAGATAAAATTACTTTATTTTTATGATCTATTTTTTTAACAACTATTTTATTATTACTTTCTTTACCTGTATTAGCAGGAGGGATTACAATATTATTATTTGACCGTAATTTAAATACTTCTTTTTATGATCCAGTTGGGGGTGGGGATCCAATTTTGTATCAACATTTATTT- 3 ’.

Biology.

Habitat. Occurs in forests (coniferous and deciduous), open meadows and pastures, if they are more or less damp and contain mushrooms and decaying plant material (e. g. beech forest, spruce plantation, oak grove, railway bank between pastures, alpine meadow, wet mowing meadow). Emerged from decaying mushrooms: Amanita phalloides (Vaill. ex Fr.) Link, 1833 (death cap), Imleria badia (Fr.) Vizzini, 2014 (bay bolete, reported as Boletus badius (Fr.) Fr., 1832 ), Phallus impudicus, Russula cyanoxantha (Schaeff.) Fr., 1863 (variegated russula), Megacollybia platyphylla (Pers.) Kotl. & Pouzar, 1972 (whitelaced shank, reported as Tricholomopsis platyphylla (Pers.) Singer, 1939 ), also from decaying petioles of Heracleum mantegazzianum . Rarely collected in Malaise traps or by sweep netting.

Flight period. May to November, seemingly earlier in southern Europe (May to October, most abundant in June and July) than in northern Europe (July to November, most abundant in August).

Hosts. Fungivorous Drosophilidae of the Drosophila quinaria species group. Mostly taken from D. phalerata ( Vet 1983; van Alphen and Vet 1986; Driessen et al. 1990), also from D. subobscura , D. kuntzei and D. transversa ( Driessen et al. 1990) .

Ex situ: Reared from Scaptomyza pallida ( Eijs and van Alphen 1999) and with lower success rates from Drosophila melanogaster ( Pannebakker et al. 2008) .

Population parameters. Host and habitat overlap with L. australis and L. longipes ( Nordlander 1980; van Alphen et al. 1991; Lue et al. 2016), also L. heterotoma ( Driessen et al. 1990) . Mean developmental time in the field: 50 days, with the males taking 2.7 days longer; entering diapause mid-July in the Netherlands which indicates discrete generations ( Driessen et al. 1990). Thelytokous with occasional development of males ( Driessen et al. 1990; van Alphen et al. 1991), though there is geographic variation within Europe: Arrhenotokous populations are present in the south, which are not infested with Wolbachia ( Pannebakker et al. 2004; Wachi et al. 2015).

Distribution.

Possibly Holarctic: in Europe mainly in Northern and central parts, records from Austria, Belgium (new record), Czech Republic, Denmark, Estonia, Finland, Germany (locus typicus of Cothonaspis clavipes ), the Netherlands, Norway, Spain, Sweden, and United Kingdom. Also present in eastern USA (and likely Canada, but none of the records confirmed), Japan, and Argentina.

Remarks.

The species was diagnosed and redescribed in Lue et al. (2021).

We sequenced one specimen from one location of L. clavipes . On BOLD, four BINs include specimens identified as L. clavipes : BOLD: ACB 6926, BOLD: ACB 7032, BOLD: AEH 2594 and BOLD: AEH 2595. Our sequence falls inside the BIN BOLD: ACB 7032. Inside this BIN are two additional specimens identified as L. clavipes , one of which was identified by Chia-Hua Lue who is the first author of the Nearctic Leptopilina revision ( Lue et al. 2016). BOLD: ACB 6926 contains eight specimens in total. They are identified as Leptopilina maia Lue & Buffington, 2016 (2), L. sp. (1), L. sp. 3 (4) and L. clavipes (1). The BIN matches sequences of L. maia in the DROP database. The BINs BOLD: AEH 2594 and BOLD: AEH 2595 are represented by several specimens that are collected in either the US or Canada. It is likely that these specimens are misidentified as L. clavipes and represent one or two different species, possibly belonging to some undescribed Nearctic species near L. clavipes available in collections (MF personal observation).