Emesis ( Mandania ) mandela Grishin
publication ID |
https://doi.org/10.5281/zenodo.16570612 |
publication LSID |
lsid:zoobank.org:pub:504B8C6D-D4AA-4489-8CE4-A636BC5F5426 |
DOI |
https://doi.org/10.5281/zenodo.16570626 |
persistent identifier |
https://treatment.plazi.org/id/42116960-6035-B33C-FE13-26015DF4B91A |
treatment provided by |
Felipe |
scientific name |
Emesis ( Mandania ) mandela Grishin |
status |
|
Emesis ( Mandania) mandela Grishin , new species
http://zoobank.org/ E971DCB7-6DA1-48D6-BF19-C1E866DE2226 ( Figs. 2 View Fig part, 4a)
Definition and diagnosis. Genomic analysis reveals that a specimen from Venezuela ( Fig. 4a View Fig ) is sister to Emesis ( Mandania) mantunga Grishin, 2025 ( type locality in Ecuador: Tungurahua) ( Fig. 4b View Fig ), but is genetically differentiated at the species level ( Fig. 2 View Fig ); e.g., their COI barcodes differ by 1.7% (11 bp, which is large for this species group ( Zhang et al. 2024, 2025b)), and, therefore, it represents a new species. This new species differs from its relatives by males with paler wing color, which is rich, reddishorange, similar in tone to burnt orange or rust. The ventral side of wings is yellower with a narrower and more weakly expressed postdiscal band of crescents but a crisper discal band; and the hindwing is more elongated towards the tornus, with a straighter outer margin. Due to its cryptic nature and unexplored individual variation, this species is best identified by DNA, with diagnostic base pairs in the nuclear genome: cne670.2.5:C84T, cne670.2.5:A102T, cne7425.1.3:A90G, cne7425.1.3:C111T, cne5229.9.3:T279A, cne22806.1.1:C183C (not T), cne22806.1.1:G184G (not A), cne22806.1.1:A198A (not T), cne5064.6.3:C75C (not T), cne5064.6.3:T80T (not A); and the COI barcode: T367C, T400C, A412G, T532C.
Barcode sequence of the holotype. Sample NVG-24033B06, GenBank PV892284, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCACTAAGATTATTAATTCGAATAGAATTAGGAACTTCAGGATCATTAATTGGTGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATACTAGGAGCTCCAGATATAGCTTTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCTCCATCTTTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCTTCTAATATTGC TCACGGAGGTTCTTCCGTAGATTTAGCTATTTTTTCCTTACATTTAGCGGGAATTTCCTCAATTTTAGGTGCAATTAACTTTATTACTACTATTATTAATATACGAATTAATAATATATCA TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCTCTCCTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACAT CATTCTTTGATCCTGCTGGTGGTGGTGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany ( MFNB), illustrated in Fig. 4a View Fig , bears the following five printed rectangular labels (text in italics handwritten), four white: [ Pto Cabello | Hahnel], [Coll. | Staudinger], [DNA sample ID: | NVG-24033B06 | c/o Nick V. Grishin], [{QR Code} MfN URI | http://coll.mfn- | berlin.de/u/ | 09f2f9], and one red [HOLOTYPE ♂ | Emesis (Mandania) | mandela Grishin ].
Type locality. Venezuela: Carabobo, Puerto Cabello.
Etymology. The name is a fusion given to this relative of mand [ana from Venezu] ela, and is treated as a noun in apposition.
Distribution. Currently known only from the holotype collected in coastal Venezuela.
Comment. This new species is the third Emesis ( Mandania) species we recorded in Venezuela, in addition to Emesis ( Mandania) mandana (Cramer, 1780) ( type locality in Suriname) and Emesis ( Mandania) mandora Grishin, 2024 ( type locality in Ecuador: Santo Domingo) ( Fig. 2 View Fig yellow highlight).
Additional records of Emesis ( Mandania) mantunga Grishin, 2025
Through expanded genomic sequencing ( Fig. 2 View Fig ), we found three more specimens of Emesis ( Mandania) mantunga Grishin, 2025 ( type locality Ecuador: Tungurahua Province, Topo; originally described from five males), including the first confirmed female (NVG-25013E02, Ecuador: Napo Province, Puerto Misahuallí , 6-Nov-1983, D. & J. Jenkins [ MGCL], Fig. 4c View Fig ), an additional male from eastern Ecuador (NVG-24033A11, Pastaza Province, Sarayacu, old, R. Haensch S., Stichel collection number 3282 [ MFNB]), and extend the distribution of this species to the eastern slopes of the Andes in northern Peru ( ♂ NVG-24033A10, San Martín Department, Tarapoto, old, Stichel collection number 4338 [ MFNB]).
MFNB |
Museo Friulano di Storia Naturale |
R |
Departamento de Geologia, Universidad de Chile |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |