Latouchia linmufu Hao, Yu & Zhang, 2025
publication ID |
https://doi.org/10.3897/BDJ.12.e137852 |
publication LSID |
lsid:zoobank.org:pub:2626A1F9-100B-4C92-9740-6C3DBED9A947 |
DOI |
https://doi.org/10.5281/zenodo.14587182 |
persistent identifier |
https://treatment.plazi.org/id/45604915-068A-59F6-9F31-A186C72713D3 |
treatment provided by |
|
scientific name |
Latouchia linmufu Hao, Yu & Zhang |
status |
sp. nov. |
Latouchia linmufu Hao, Yu & Zhang sp. nov.
Materials
Type status: Holotype. Occurrence: recordedBy: J. Lin; sex: male; occurrenceID: BA3628FF-4FC0-55A9-8915-75C521E1F2B2; Taxon: scientificName: Latouchia linmufu sp. nov.; Location: country: China; stateProvince: Hunan; county: Pingjiang; locality: Mufu Mountain National Forest Park ; verbatimElevation: 1500 m; verbatimCoordinates: 113.81 ° E, 28.96 ° N; Identification: identifiedBy: L. Hao; Event: eventDate: 19 November 2022; Record Level: institutionCode: MHBU-ARA- 10000052; KYUARA # 1981 GoogleMaps
Type status: Paratype. Occurrence: recordedBy: J. Lin; sex: female; occurrenceID: 38197A48-1DB8-5C7B-BBCF-F5D67BB1D3A6; Taxon: scientificName: Latouchia linmufu sp. nov.; Location: country: China; stateProvince: Hunan; county: Pingjiang; locality: Mufu Mountain National Forest Park ; verbatimElevation: 1500 m; verbatimCoordinates: 113.81 ° E, 28.96 ° N; Identification: identifiedBy: L. Hao; Event: eventDate: 19 November 2022; Record Level: institutionCode: MHBU-ARA- 10000053; KYUARA # 1982 GoogleMaps
Type status: Paratype. Occurrence: recordedBy: J. Lin; sex: male; occurrenceID: 812166DB-BEA3-5F1A-BF6A-DEE3114DD382; Taxon: scientificName: Latouchia linmufu sp. nov.; Location: country: China; stateProvince: Hunan; county: Pingjiang; locality: Mufu Mountain National Forest Park ; verbatimElevation: 1500 m; verbatimCoordinates: 113.81 ° E, 28.96 ° N; Identification: identifiedBy: L. Hao; Event: eventDate: 19 November 2022; Record Level: institutionCode: MHBU-ARA- 10000054; KYUARA # 1985 GoogleMaps
Description
Male ( Holotype, MHBU-ARA- 10000052). Colouration in ethanol (Fig. 7 View Figure 7 A). Carapace and chelicerae yellowish-brown, with eye mound and outer edge of carapace darker; area between eye mound and fovea slightly darker than rest of carapace. Legs yellowish-brown, with femora gradually transitioning to slightly deeper hue from proximal to distal, darker than rest of legs. Opisthosoma: dorsal side black-grey, with indistinct dark pattern; ventral side slightly yellower than dorsal side; booklung covers yellower than other ventral areas. Ventral side of whole body generally brighter than dorsal side; sigilla slightly darker than rest of sternum (Fig. 7 View Figure 7 C); palpal coxa and labium slightly darker.
Total length 8.97. Carapace 4.68 long, 4.50 wide; opisthosoma 4.25 long, 2.40 wide. Eye group 0.49 long, 0.72 wide anteriorly, 0.74 wide posteriorly; MOA 0.35 long, front width 0.37, back width 0.49. Eye diameters and interdistance: AME 0.14, ALE 0.24, PME 0.10, PLE 0.24, AME – AME 0.08, AME – ALE 0.05, ALE – PLE 0.08, PME – PME 0.28, PME – PLE 0.04. Palpal coxa 1.52 long, 0.94 wide, bearing 9 / 9 spinules on prolateral-proximal corner. Sternum 2.46 long, 2.35 wide. Labium 0.70 long, 0.81 wide, with one spinule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carrying six and four stout spines, respectively; chelicerae groove with 7 / 5 and 5 / 4 teeth of different sizes on promargin and retromargin, respectively.
Leg formula 4123; measurements: I 14.29 (4.72, 1.70, 3.43, 2.95, 1.49), II 11.86 (3.75, 1.16, 2.81, 2.41, 1.73), III 11.55 (3.41, 1.37, 2.01, 2.91, 1.85), IV 16.99 (5.21, 1.73, 3.71, 3.88, 2.46). Spines on femora to metatarsi of legs I – II straight, sword-like (typical); strong spines on the prolateral patellae of leg I and II, ventrally few typical or absent; spines on prolateral tibiae of legs I – II relatively short, more numerous and stouter on leg II, ventrally more elongate on both legs, three especially elongate spines medially on leg II (Fig. 8 View Figure 8 E and Fig. 16 e View Figure 16 e ); metatarsi I – II spineless and tarsi I – IV spineless. Spination of leg I, patellae, Mpd (1-1 - 1) / (1-1 - 2), Dpv (1) / (1), Drv (1) / (1); tibiae, Mp (1-2 - 1 - 1) / (2-1), Dpv (1) / (1), v (1-1 - 1 - 1 - 1) / (1-1 - 1 - 2). Spination of leg II, patellae, Mpd (1-2) / (1-2); tibiae, Mp (1-1 - 3 - 2) / (1-1 - 1 - 1 - 1), Dpv (1) / (1), v (1-1 - 1 - 1) / (1-1 - 1 - 1). Tibia III unmodified, without demi-saddle shape. Trichobothria of legs present on proximal one-third part of tibiae I – IV, distal half of metatarsi I – III, distal two-thirds part of metatarsus IV and dorsal side of all tarsi; trichobothria on tibiae I – IV and metatarsi I – IV unmodified; trichobothria on tarsi I – III divided into unmodified and clavate forms, with former irregularly distributed across almost entire dorsal surface and latter only present in proximal half, trichobothria on tarsi IV unmodified. Count of trichobothria on legs: I, tibia 3 / 2 pd and 4 / 2 rd, metatarsus 6 / 5, tarsus 11 / 11 unmodified and 1 / 2 clavate; II, tibia 4 / 4 pd and 4 / 3 rd, metatarsus 6 / 5, tarsus 7 / 9 unmodified and? / 2 clavate; III, tibia 2 / 3 pd and 3 / 3 rd, metatarsus 4 / 5, tarsus 5 / 14 unmodified and? / 2 clavate; IV, tibia 4 / 5 pd and 4 / 3 rd, metatarsus 4 / 5, tarsus 14 / 12 unmodified. Tarsal claws: paired claws with five teeth in different sizes on tarsi I – IV (Fig. 8 View Figure 8 F); unpaired claw bare, without denticle.
Palp 5.39 long (1.76, 1.11, 1.63, 0.89). Trichobothria on palpal tibia unmodified, present on proximal one-third part, on cymbium divided into unmodified and clavate forms, with latter occupying majority of trichobothrial area, while former sparsely distributed at distal end of trichobothrial area; count of trichobothria: tibia 3 / 2 pd, 3 / 3 rd, cymbium 3 / 4 unmodified and 4 / 3 clavate. Tibia cylindrical, proximal one-third of tibia widest and slightly narrowing to distal, with one lyriform organ on ventro-prolateral side of sub-distal part (Fig. 7 View Figure 7 E and F); tibia without spine or spinule. Palpal organ: Tegulum oval (Fig. 7 View Figure 7 G – J and Fig. 8 View Figure 8 A – C); the relatively straight and needle-like embolus, gradually narrowing from the proximal to distal end and the absence of obvious keel or ridge on the embolus, the length approximately as the width of tegulum.
Female ( Paratype, MHBU-ARA- 10000053). Colouration in ethanol (Fig. 7 View Figure 7 B). Carapace like male, but slightly darker, eye mound and fovea dark; area below the eye mound having two bands, burnt red; chelicerae colour as carapace. Colour between palp and each leg without significant difference, overall similar in colour to carapace. Opisthosoma: dorsal side brownish-black, with dense and small irregular pale spots; area around cardiac muscle spot obviously pale. Ventral side of whole body generally brighter than dorsal side; sigilla darker than rest of sternum (Fig. 7 View Figure 7 D).
Total length 9.89. Carapace 4.88 long, 4.24 wide; opisthosoma 4.99 long, 3.34 wide. Eye group 0.44 long, 0.64 wide anteriorly, 0.68 wide posteriorly; MOA 0.34 long, front width 0.37, back width 0.56. Eye diameters and interdistance: AME 0.14, ALE 0.25, PME 0.12, PLE 0.22, AME – AME 0.09, AME – ALE 0.09, ALE – PLE 0.10, PME – PME 0.31, PME – PLE 0.03. Palpal coxa 1.21 long, 0.77 wide, bearing 13 / 12 cuspules on prolateral-proximal corner. Sternum 2.59 long, 2.74 wide. Labium 0.72 long, 0.88 wide, without spinule or cuspule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carrying 10 and eight stout spines, respectively; chelicerae groove with 5 / 5 and 5 / 5 teeth of different sizes on promargin and retromargin, respectively.
Leg formula 4123; measurements: I 8.51 (3.04, 1.92, 1.66, 1.11, 0.78), II 7.75 (2.74, 1.65, 1.312, 1.15, 0.89), III 7.00 (2.30, 1.49, 1.14, 1.22, 0.85), IV 10.50 (3.75, 1.47, 1.99, 1.75, 1.54). Spines of legs I – II primarily distributed on p, pd, r and rv of tibia, as well as p, pv, r and rv of metatarsus and tarsus; most spine tips weakly curved downwards, forming slight hook-shape; some spines on rv longer and not curved at tip. Leg III – IV with tarsus carrying a distal ventral of short stiff bristles. Slender spines on dorso-distal and ventral side of metatarsus III – IV. Tibia III significantly shortened, without demi-saddle shape, groups of short strong spines on dorso-lateral side of tibia and on apical and prodorsal sides of patella III; patella IV with dorso-proximal group of short stiff bristles and few short spines. Trichobothria of legs present on proximal one-third part of tibiae I – IV, distal half of metatarsi I – IV and proximal two-thirds of all tarsi; trichobothria on tibiae I – IV and metatarsi I – IV unmodified; trichobothria on tarsi I – III divided into unmodified and clavate forms, with latter only present in proximal half of tarsus , trichobothria on tarsi IV unmodified. Count of trichobothria on legs: I, tibia 4 / 4 pd and 3 / 4 rd, metatarsus 7 / 6, tarsus 11 / 10 unmodified and 3 / 3 clavate; II, tibia 4 / 4 pd and 4 / 4 rd, metatarsus 7 / 5, tarsus 10 / 12 unmodified and 3 / 1 clavate; III, tibia 3 / 4 pd and 4 / 4 rd, metatarsus 6 / 7, tarsus 9 / 12 unmodified and 1 / 3 clavate; IV, tibia 6 / 5 pd and 5 / 5 rd, metatarsus 5 / 6, tarsus 8 / 9 unmodified. Tarsal claws: all paired claws with two teeth on common base (Fig. 8 View Figure 8 G); unpaired claw bare, without denticle. Palp 5.39 long (1.76, 1.11, 1.63, 0.89), spines on palp distributed on p, pv, r rv of tibia and tarsus; palpal tarsal claw with one basal tooth.
Vulva (Fig. 7 View Figure 7 K and Fig. 8 View Figure 8 D). Two separate sperm receptacles connected to atrium via slightly tapered stalk; inner edge at the connection between the stalk and spermathecae is conspicuously concave; sperm receptacles slightly outwardly inclined. Overall mushroom-shaped. Tan glandular pores uniform present on distal half of stalk and entire sperm receptacle. Glandular pores also present on basal half of stalk and atrium, despite being sparser and lighter in colour.
Diagnosis
The male of the new species can be distinguished from congeners by the relatively straight and needle-like embolus (Fig. 7 View Figure 7 G – I), gradually narrowing from the proximal to distal end and the absence of obvious keel or ridge on the embolus, whereas in other species, the embolus may exhibit varying degrees of bending or possess a distinct keel or ridge. The shape of female spermathecae is similar to those of L. formosensis smithi , but differs in that the inner edge at the connection between the stalk and spermathecae is conspicuously concave in the dorsal view, whereas in L. formosensis smithi , the inner edge of connection between the stalk and spermathecae is smooth, lacking the obvious concavity (see Tso et al. (2003): fig. 40). The female also can be distinguished from the geographically close L. hunanensis Xu et al. 2002 by the sperm receptacles slightly outwardly inclined.
Etymology
The specific epithet is a combination of the family name of the collector (Lin) and the type locality (Mufu Mountain); noun in apposition.
Distribution
Known only from the type locality of Hunan, China (Fig. 17 View Figure 17 ).
DNA barcode
GGAAGATTGTTTGGGGATGATCATTTGTATAATGTAATTGTGACTGCACATGCTCTTGTGATGATTTTTTTTATAGTGATGCCTATTATGATTGGCGGTTTTGGCAATTGGTTGTTGCCTATAATGATTGGGGCTCCTGATATGGCATTTCCTCGAATAAATAATTTTAGATTTTGGTTGTTACCTCCTTCTTTGTTTTTGCTTTTGCTGTCTTCTCTAGTGGGTGAGGGGGTTGGAGCAGGGTGAACTATTTATCCTCCCTTGTCTTCGGGGATGGGACATAGAGGAGGGGGTGTGGATTTTGCTATTTTTTCTTTGCATTTAGCGGGGGCGTCCTCAATTATGGGGTCGATTAATTTTATTTCTACTATTATTAATATGCGGGCTAGGGGGATGGATATGGAGAGGGTGCCTTTGTTTGTGTGGTCAGTGTTAATTACTACAGTGTTGCTTTTGTTGTCCTTGCCGGTTCTGGCAGGGGCTATTACGATGTTGTTGACTGATCGTAATTTTAATACTTCGTT (GenBank accession number: PQ 585638).
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.