Telegonus (Rhabdoides) flavimargo Grishin, 2025
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
DOI |
https://doi.org/10.5281/zenodo.16806288 |
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4B13-7265-FEEC-FF01A801F958 |
treatment provided by |
Felipe |
scientific name |
Telegonus (Rhabdoides) flavimargo Grishin |
status |
new species |
Telegonus (Rhabdoides) flavimargo Grishin , new species
http://zoobank.org/ 597C1EFD-5F59-494C-9E23-1E8C549FB043 ( Figs. 61 View Fig part, 80, 81c–d, 89 part)
Definition and diagnosis. A female from Costa Rica with solid-yellow ventral hindwing margins identified by Steinhauser as “ T. latimargo ” does not group in the Z chromosome tree either with this species or any other pale-margined species of Telegonus Hübner, [1819] ( type species Papilio talus Cramer, 1777 ). Instead, it is confidently placed as sister to Telegonus tinda Evans, 1952 ( type locality in Brazil: Pará) ( Fig. 61b View Fig ). In the tree constructed from the autosomes, this female is sister to a clade composed of several species ( Fig. 61a View Fig ). Therefore, it represents a new species. This new species keys to “ Astraptes latimargo bifascia ” C.14.29(a) in Evans (1952) (Evans misidentified both T. bifascia and T. latimargo , see above) or to “ Astraptes chiriquensis chiriquensis ” C.14.30(a). It differs from Telegonus grullus ( Mabille, 1888) , stat. rest. (and this is the species Steinhauser meant by “ latimargo ” in his identification, see below for the justification of the species status) by yellower (vs. whiter) ventral hindwing margins more weakly shaded with brown towards the tornus, a postdiscal dark band on the ventral forewing that is farther from the discal band, and narrower and less prominent ventral forewing dark bands. The new species is sister to T. tinda in the Z chromosome and differs from it by bluer rather than greener wing bases and body above and a yellower ventral side with a broad yellow margin lacking in T. tinda . It differs from other relatives by the following combination of characters in females: more extensive and bluer than in Telegonus chiriquensis Staudinger, 1875 ( type locality in Panama: Chiriquí) iridescent area at the base of the dorsal forewing; darker tornal area on the ventral forewing and the submarginal yellow region being the broadest close to the middle of the wing and narrowing towards the tornus; dark postdiscal band on the ventral forewing that is equidistant from the apical and discal bands (not closer to the apical band); more weakly expressed dark bands on the dorsal forewing; and somewhat shorter and not as strongly sclerotized in its anterior half lamella postvaginalis, which has a V-shaped central notch. Due to the cryptic nature of this species (compared to T. grullus ), most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly128.9.3:G576T, aly770.37.4:C579T, aly54.29.1:A462T, aly54.29.1:T486C, aly 2165.5.2: G195A, aly164.11.12:C55C (not T), aly164.11.12:C75C (not T), aly2874.16.4:G81G (not T), aly 1196.6.1: C45C (not T), aly671.39.1:A900A (not G); and COI barcode: A34G, T49T, T206C, T407C, T508G.
Barcode sequence of the holotype. Sample NVG-14105A05, GenBank PV550026, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGGTTAATTGGAACCTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTCCCACTAATAATAGGAGCCCCTGATATAGCTTTTCCTCGTA TGAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCCGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCATCAAGGAGCATCAGTTGATCTAGCTATTTTCTCTTTACATCTAGCTGGTATTTCTTCTATTCTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTGTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 80 View Fig (genitalia Fig. 81c, d View Fig ), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [Guapiles | CR | 850ft. alt], [Collection | WmSchaus], [ Telemachus latimargo ♀ | ( Herrich-Schäffer, 1869) | Det. S.R. Steinhauser], [DNA sample ID: | NVG-14105A05 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23119E12 | c/o Nick V. Grishin ], [genitalia: | NVG240817-51 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♀ | Telegonus (Rhabdoides) | flavimargo Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection .
Type locality. Costa Rica: Limón Province, Guapiles , elevation 850’.
Etymology. The name is given for the yellow ( flavus in Latin) marginal area of the ventral hindwing. The name is treated as a masculine noun in apposition.
Distribution. Currently known only from the holotype, female, collected in north-central Costa Rica.
Comment. We list data on all labels of the holotype, verbatim, including identification labels. One of such labels contains an unpublished name “ Telemachus .” Here, we use Art. 8.3. of the ICZN Code and disclaim the name “ Telemachus ” for nomenclatural purposes. Thus, we consider this name to be unpublished.
USNM |
Smithsonian Institution, National Museum of Natural History |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
SubFamily |
Eudaminae |
Tribe |
Eudamini |
Genus |