Aethilla weymeri Plötz, 1882

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 102-103

publication ID

https://doi.org/10.5281/zenodo.16642576

DOI

https://doi.org/10.5281/zenodo.16415042

persistent identifier

https://treatment.plazi.org/id/4D7E87DA-4B19-726F-FE1B-FE20ABF2FB9A

treatment provided by

Felipe

scientific name

Aethilla weymeri Plötz, 1882
status

 

Lectotype designation for Aethilla weymeri Plötz, 1882 View in CoL

Aethilla weymeri Plötz, 1882 View in CoL was described from an unstated number of specimens of unknown provenance ( Plötz 1882b). Being absent from the 1876 version in the ZSMC library, this species was added to the manuscript near its publication. Furthermore, Plötz did not specify the number of his drawing for A. weymeri View in CoL and instead stated “Nachtr.” meaning Nachtrag (supplement). It is possible that the drawing was not made at the time of publication. Later, this drawing was given the number 1342, as specified by Godman (1907), who stated that the illustrated specimen was from Chiriquí and selected a specimen from his collection that agreed best with the illustration. This specimen in BMNH bearing a label “Compared with Plotz’s drawing of weymeri, Plötz View in CoL ” may serve as a proxy for the lost drawing. It is from Tabasco, Mexico, and has broadly yellow submarginal areas on the ventral hindwings but dark (not yellow, as per the original description) fringes and brighter cyan-blue (rather than dark green in the description) dorsal overscaling. Images of this specimen, photographed by N.V.G., are shown on the Butterflies of America website ( Warren et al. 2024).

To learn more about A. weymeri View in CoL , we searched for its syntypes in MFNB, where the Weymer collection is deposited. We reason that Plötz proposed the name to honor Weymer, who might have discovered this species. We found two specimens that match the original description of A. weymeri View in CoL rather well, e.g., they have dark green (not blue) overscaling at wing bases and body above, pale yellowish-gray palpi beneath, orange-yellow fringes on the hindwing, and a yellow outer marginal area on the ventral hindwing broadest at the tornus. Both specimens bear a label with the name “victa”: “victa m il” and “victa Wmr il.” suggesting that Weymer considered these specimens to be a new species that he wanted to name “victa”. On the first specimen, “m” stands for “mihi” (Latin for “of me”), placed after a species name as an attribution of the new species to the writer. This notation was common over a century ago, instead of the author’s name being written directly. On the second specimen, Weymer used the abbreviation of his last name “Wmr”. On both specimens, “il” is for “in litteris,” meaning that the name has not been published. Moreover, a label on the first specimen states “n sp. 462 Plötz”, and we interpret it as indicating that Plötz considered the specimen number 462 in Weymer’s collection to be a new species.

The first specimen does not have a locality label. The second specimen bears a label “Central Amer” and collection year 1887. The second specimen was collected after the description of A. weymeri in 1882 and, therefore, cannot be a syntype. However, we consider the first specimen to be a syntype of A. weymeri , because it matches the original description well, is from Weymer’s collection (thus proposing a patronym would make sense), and has been regarded by Plötz as a new species. We hypothesize that Plötz inspected Weymer’s collection and told him this specimen represented a new species. Weymer decided to propose a name “victa” for it. However, this name was not published by Weymer, but Plötz added this species into his key as “weymeri ” right before publication. The syntype did not have a locality label, and Plötz could not have stated the locality of A. weymeri in his publication. However, later, the second specimen of “victa” was collected in Central America, and when Plötz was preparing the drawing, he listed the locality as “ Chiriqui ”. It is possible that other specimens of “victa” with the locality “ Chiriqui ” also existed, and maybe they were illustrated by Plötz instead of the syntype.

To stabilize nomenclature and define the name A. weymeri objectively, N.V.G. hereby designates this found syntype in the MFNB collection illustrated in Fig. 76 View Fig and bearing the following six labels (1st, 2nd, and 3rd handwritten, others printed): [462 | Weymer], [victa m il | n sp. 462 Plötz], [? Aethilla ], [Coll. Weymer], [{QR Code} http://coll.mfn-berlin.de/u/ | 44a098], [{QR Code} MfN URI | http://coll.mfn- | berlin.de/u/ | 09f692], [DNA sample ID: | NVG-24028C11 | c/o Nick V. Grishin ] as the lectotype of Aethilla weymeri Plötz, 1882 . The first three labels are in Weymer’s handwriting. The lectotype is missing the club of the left antenna, its right antenna overlays the forewing on the dorsal side, and the tornus of its right hindwing is repaired; pieces of wings of other specimen(s) glued to the lectotype to repair it are hereby excluded from the lectotype. The type locality of A. weymeri is likely in Panama: Chiriquí (Godman 1907). Consistently, genomic sequencing places the lectotype among specimens from Central America. The COI barcode sequence of the lectotype, sample NVG-24028C11, GenBank PV550022, 658 base pairs, is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTCATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACC ATTGTAACAGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTCCCATTAATAATAGGAGCCCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGACTTTTACCCCCGTCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCCCTTTCATCTAATATTGC CCATCAAGGAGCATCAGTTGATTTAGCTATTTTTTCCTTACATTTAGCTGGTATTTCCTCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCACTACCAGTTTTAGCAGGAGCTATTACCATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCTGGGGGAGGAGATCCAATTTTATACCAACATTTATTT

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Lepidoptera

Family

Hesperiidae

SubFamily

Eudaminae

Tribe

Eudamini

Genus

Aethilla

GBIF Dataset (for parent article) Darwin Core Archive (for parent article) View in SIBiLS Plain XML RDF