Telegonus (Rhabdoides) pallidus Grishin

Telegonus (Rhabdoides) pallidus Grishin , new species

http://zoobank.org/ F10DDFE4-038B-40DF-94D0-FE6F2DAE6772 ( Figs. 61 View Fig part, 63i–j, 70, 89 part)

Definition and diagnosis. A sequenced specimen from Panama (in USNM collection) that is phenotypically similar to Ecuadorian Telegonus cyprus crilla (Evans, 1952) , comb. nov. due to the presence of a pale spot in the middle of the dorsal forewing is not monophyletic with it in trees constructed from the autosomes in the nuclear genome ( Fig. 61a View Fig ) and the mitochondrial genome ( Fig. 61c View Fig ), and instead is closer related to Telegonus crana (Evans, 1952) , stat. nov. (type locality Guatemala: Geronimo), being genetically differentiated from it at the species level ( Fig. 61 View Fig ); e.g., their COI barcode difference is 3.5% (23 bp). Therefore, this Panamanian specimen represents a new species. This new species keys to “ Astraptes creteus crilla ” C.14.28(b) in Evans (1952) due to the presence of a white spot in the middle of the dorsal forewing, but differs from it by this spot being smaller and stronger overscaled with brown around its edges, the pale area in the ventral forewing discal cell being heavier overscaled with brown, especially along the vein, and a more elongated hindwing. The new species differs from T. crana , to which it is closely related, by being paler, as reflected in having a pale spot and a smear around it in the middle of dorsal forewing; a paler costal area from the base to the middle of the ventral forewing (browner in T. crana ), this area is also merged with the central band; and heavier yellowish overscaling on the ventral hindwing. The ampulla is smaller and wider separated from the dorsal process of the harpe ( Fig. 63i View Fig ). Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly1651.38.1:T651C, aly1651.38.1:C1146T, aly839.26.4:G214A, aly839.26.4:A224T, aly536.8.1:G510A, aly276890.2.8:A45A (not G), aly276890.2.8:C63C (not T), aly322.44.3:T42T (not C), aly322.44.3:T52T (not G), aly222.2.10: G90G (not T); and COI barcode: A100C, C220T, T292C, T232C, C364C, T400C, C478C.

Barcode sequence of the holotype. Sample NVG-14111D04, GenBank PV550016, 658 base pairs: AACTTTATACTTTATTTTTGGAATTTGAGCAGGATTAGTTGGAACCTCTTTAAGTTTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGCGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCTTTAATAATAGGAGCTCCTGATATAGCCTTTCCACGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATCTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCATCAAGGAACATCAGTTGACTTAGCAATTTTTTCCCTACACTTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAACTTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAACTTAAATACTT CATTTTTTGACCCAGCGGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 70 View Fig (genitalia Fig. 63i, j View Fig ), bears the following five printed rectangular labels, four white: [ PANAMA: Darien | Cana 1550m | 5. VI.1983 | Leg. G. B. Small], [DNA sample ID: | NVG-14111D04 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23119E08 | c/o Nick V. Grishin ], [genitalia: | NVG240817-47 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | pallidus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection.

Type locality. Panama: Darién Province, Cana , elevation 1550 m.

Etymology. The name is given for the paler aspect of this species compared to its relatives. The name is a masculine adjective.

Distribution. Currently known only from the holotype collected in eastern Panama.