Telegonus (Rhabdoides) alector ecuadoricus Grishin, 2025

Telegonus (Rhabdoides) alector ecuadoricus Grishin , new subspecies

http://zoobank.org/ 2CAECE29-3F03-40DC-9A82-8D56D3940278 ( Figs. 61 View Fig part, 62, 63a–b, 89 part)

Definition and diagnosis. Genomic analysis reveals that two specimens from Ecuador, while being closely related to Telegonus alector (C. Felder & R. Felder, 1867) (type locality Colombia: Bogota) are genetically differentiated from it and form a clade sister to T. alector from Panama, Colombia and Venezuela ( Fig. 61 View Fig ), although this differentiation is small. Their COI barcodes differ by 1.1% (7 bp). This barcode difference is larger than expected from nuclear genomic divergence ( Fig. 61 View Fig ) and, therefore, this new taxon is conservatively proposed as a subspecies. This new subspecies keys to “ Astraptes alector alector ” C.14.26(b) in Evans (1952) and is similar to it in having brilliant blue (not greenish) wing bases and body above, and a white central band on the forewing in males. It differs from the nominate subspecies by its males with a more weakly expressed white central band on the dorsal forewing, which is heavier overscaled with brown, and its portion in the discal cell is very much reduced; a more prominent white costal area on the ventral forewing that reaches nearly half of the wing from the base; and a more strongly developed dark ventral wing pattern, including forewing subapical band and hindwing bands. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly294.13.1:T424A, aly294.13.1:T501A, aly3507.2.7:C39T, aly3507.2.7:A113C, aly322.20.17:C99T; and COI barcode: A43T, C136C, G477A, A517A, T568C, T646C.

Barcode sequence of the holotype. Sample NVG-19071H10, GenBank PV550010, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGTACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTACAATACT ATTGTAACAGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATAATAGGAGCCCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCATCAAGGAGCATCAGTTGACTTAGCAATTTTCTCTTTACATTTAGCTGGTATTTCTTCTATTCTTGGAGCTATTAATTTTATCACAACAATTATTAATATACGAATTAATAATCTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATCACAGCATTATTATTATTACTTTCTTTACCAGTTTTAGCAGGAGCCATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATACCAACACTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 62 View Fig (genitalia Fig. 63a, b View Fig ), bears the following six printed rectangular labels, five white: [ ECUADOR: Esmeraldas: | Río Chuchuví, km. 12.5 Lita- | San Lorenzo rd. 800-900m | 0° 53.01' N 78° 30.90' W | III.2001 I.Aldas leg.], [DNA sample ID: | NVG-19071H10 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23119E04 | c/o Nick V. Grishin ], [genitalia: | NVG240817-43 | c/o Nick V. Grishin ], [USNMENT | {QR Code} | 01588533], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | alector ecuadoricus | Grishin ]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. GoogleMaps Paratype: 1♂ NVG-14111C04 Ecuador, Imbabura, Rumiñahui, 37 km N of Pedro Vicente Maldonado, elevation 500 m, GPS 0.2788, −78.9983, Apr-2001, I. Aldas leg. [ USNM] GoogleMaps .

Type locality. Ecuador: Esmeraldas Province, Río Chuchuví, km 12.5 of Lita–San Lorenzo Road   GoogleMaps , elevation 800-900 m, GPS 0.8835, −78.5150.

Etymology. The name is given for the type locality and is treated as a masculine noun in apposition.

Distribution. Currently known only from northwestern Ecuador.