Aethilla toxeus Plötz, 1882
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
DOI |
https://doi.org/10.5281/zenodo.16804195 |
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4B39-724F-FF67-FF12AB44FC97 |
treatment provided by |
Felipe |
scientific name |
Aethilla toxeus Plötz, 1882 |
status |
|
Aethilla toxeus Plötz, 1882 View in CoL is confirmed as a junior subjective synonym of Cecropterus (Murgaria) albociliatus albociliatus (Mabille, 1877)
To put our surprising hypothesis that Aethilla toxeus Plötz, 1882 (type locality in Mexico) is a junior subjective synonym of Cecropterus (Murgaria) albociliatus albociliatus (Mabille, 1877) (type locality in Colombia, Panama, and Guatemala) (Zhang et al. 2023d) to further test and to determine the phylogenetic position of the lectotype more precisely, we sampled and sequenced another leg of the A. toxeus lectotype in MFNB along with additional specimens of C. albociliatus . Genomic phylogenetic trees place the new sample of A. toxeus (NVG-24028H08) together with the previously sequenced (NVG-15032A10) ( Fig. 57 View Fig magenta), thus confirming the synonymy. The COI barcode sequence of the lectotype, sample NVG- 15032A10, GenBank PV550007, 658 base pairs, is: AACCTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTAGGAACTTCTTTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCCCTTATATTAGGAGCCCCTGACATAGCTTTCCCTCGTA TAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGTACTGGATGAACAGTTTATCCCCCTTTATCCTCTAATATTGC CCACCAAGGAGCATCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGAATTTCTTCTATTCTTGGAGCTATTAACTTTATTACAACTATTATTAATATACGAATTAATAATTTATCA TTTGATCAAATACCATTATTTATTTGAGCTGTCGGAATTACAGCCTTATTATTATTACTTTCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCTGCCGGTGGAGGAGATCCTATTTTATATCAACATTTATTT
Furthermore, in our previously published nuclear tree that was based on a small number of specimens (Zhang et al. 2023d), the lectotype of A. toxeus was sister to all other included specimens of C. albociliatus (even of other subspecies), albeit with a non-significant bootstrap support of 15% (fig. 8a in Zhang et al. 2023d). However, with additional specimens sequenced and the quality of the A. toxeus lectotype dataset improved by the second sequencing, it is now positioned within C. albociliatus albociliatus specimens ( Fig. 57 View Fig magenta within blue), sister to one specimen from Mexico: Oaxaca with 74% bootstrap support in the nuclear genome tree ( Fig. 57a View Fig ). Although not sufficient for a confident conclusion, mainly because other specimens from Oaxaca are scattered throughout the phylogenetic tree, this position of the A. toxeus lectotype suggests that it might have been collected in Oaxaca. The collector of the lectotype, Ferdinand Deppe, indeed collected in Oaxaca, among several other places in southern Mexico (e.g., Veracruz) ( Stresemann 1954). Moreover, the holotype of Apyrrothrix araxes cyrillus (Plötz, 1879) , also collected by Deppe, is from Oaxaca. Additional genomic sequencing, coupled with population-level analysis of these datasets, may provide a more definitive answer regarding the provenance of the A. toxeus lectotype.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
SubFamily |
Eudaminae |
Tribe |
Eudamini |
Genus |