Damas lavandas Grishin, 2025
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
DOI |
https://doi.org/10.5281/zenodo.16647091 |
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4BC0-72C8-FD93-FA80ACE1FA44 |
treatment provided by |
Felipe |
scientific name |
Damas lavandas Grishin |
status |
new species |
Damas lavandas Grishin , new species
http://zoobank.org/ 008D4653-DE83-4E6D-B40A-050D3C1C8F2A
( Figs. 149l–m View Fig , 152 View Fig part, 154)
Definition and diagnosis. Three specimens from the Tambopata National Reserve are genetically differentiated from other Damas Godman, 1901 (type species Goniloba clavus Herrich-Schäffer, 1869 ) at the species level, forming a separate clade in the deep radiation of the genus ( Fig. 152 View Fig red) and, therefore, represent a new species. This new species keys to Damas clavus (K.26) in Evans (1955) and differs from all its congeners by the combination of the following characters in males: strong purple tinge on the ventral side of wings: in the apical third of the forewing and most of the hindwing except the posterior third; smaller stigma with a shorter and rounder upper section; three subapical semi-hyaline spots; forewing discal cell with a single semi-hyaline yellowish smaller spot at the lower part of the forewing discal cell; the posteriorly directed spike-like process of the tegumen is not reaching the end of the uncus, the harpe is terminally rounded, with a longer and slightly concave dorsoposterior margin that is finely serrated and with a narrower tooth by the ampulla that is directed anterodorsad, uncus arms are terminally converging, narrower. Due to the partly cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly390.22.4:A72G, aly390.22.4:G105A, aly822.25.2:A105G, aly26.20. 2:G531A, aly26.20.2:G552A; and COI barcode: T151C, T178C, T205C, C277T, T523C.
Barcode sequence of the holotype. Sample NVG-23123B07, GenBank PV550072, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGATTACTAGGAACTTCTTTAAGTATATTAATTCGAACAGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACA ATTGTTACAGCTCATGCCTTTATTATAATCTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGTAATTGATTAGTACCCTTAATATTAGGTGCCCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGAATATTACCTCCATCTTTAATCTTATTAATTTCAAGAAGAATCGTAGAAACTGGAGCAGGAACTGGTTGAACTGTTTACCCCCCTCTTTCCTCCAATATTGC TCACCAAGGAGCTTCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACTACAATCATTAATATACGTGTAAGAAATTTATCA TTTGATCAAATACCCTTATTTGTATGATCAGTAGGAATCACAGCCCTTTTACTACTTTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATCTTAATACTT CTTTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 154 View Fig , bears the following three printed (text in italics handwritten) rectangular labels, two white: [ PERU Madre De Dios | Rio La Torre 300m | Tambopata Res. | 29 Sept.'86 | S. S. Nicolay], [DNA sample ID: | NVG-23123B07 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Damas lavandas | Grishin ]. Paratypes: 2♂♂ from Peru, Madre de Dios: 1♂ NVG-23123B05 30 km SW of Puerto Maldonado, 300 m, 17-Oct-1983, S. S. Nicolay leg. [ USNM] and 1♂ NVG-24099C06 (leg DNA extraction, sequenced), NVG-24127F09 (abdomen DNA extraction and dissection) 60 km S of Puerto Maldonado, Rio Tambopata , 25-Oct-1999, D. & J. Lindsley leg., genitalia NVG250517 -06 ( Fig. 149l, m View Fig ) [ MGCL] .
Type locality. Peru: Madre de Dios Region, Tambopata National Reserve, Rio La Torre , elevation 300 m.
Etymology. In Spanish, lavanda means lavender. The name rhymes with the genus name and is given for the purplish sheen on the ventral side of this species. The name is treated as a noun in apposition.
Distribution. Currently known only from the Tambopata National Reserve in southeastern Peru.
Comment. This species is sympatric with Damas kenos sp. n., in the Tambopata National Reserve, Peru.
USNM |
Smithsonian Institution, National Museum of Natural History |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
SubFamily |
Hesperiinae |
Tribe |
Hesperiini |
Genus |
|
SubGenus |
Ochluma |