Damas clavus ( Herrich-Schäffer, 1869 ),
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
DOI |
https://doi.org/10.5281/zenodo.16641655 |
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4BCB-72B0-FEC2-FB04ABF2FB59 |
treatment provided by |
Felipe |
scientific name |
Damas clavus ( Herrich-Schäffer, 1869 ) |
status |
|
Lectotype designations and comments on the type localities of the taxa in the Damas clavus ( Herrich-Schäffer, 1869) View in CoL complex
Currently, the following eight available names are regarded as junior subjective synonyms of Goniloba clavus Herrich-Schäffer, 1869 (type locality not specified): Goniloba corope Herrich-Schäffer, 1869 (type locality not specified), Carystus orope Capronnier, 1874 (Plötz in litt.) (type locality includes at least Botafogo, Rio de Janeiro, Brazil), Hesperia crataea Hewitson, 1876 (type locality in Brazil: Bahia), Proteides cervus Möschler, 1877 (type locality in Suriname), Hesperia angulis Plötz, 1886 (type locality in Panama), Proteides ampyx Mabille, 1891 (type locality in Panama), Thracides polles Godman, 1901 (type locality in Nicaragua, Panama, and Brazil), and Perichares tripuncta Draudt, 1923 (type locality stated as South Brazil on the label of the lectotype). To gain further insights into the relationships between these taxa, we located primary type specimens of all but one of them. While P. tripuncta is already represented by the lectotype, others are syntypes, and we designate lectotypes for six names in this section and one in the next.
To stabilize nomenclature and define the name Goniloba clavus Herrich-Schäffer, 1869 (type locality not specified) objectively, N. V. G. hereby designates a syntype in the MFNB collection, a female that bears the following ten rectangular labels (1 st purple, others white; 2 nd, 3 rd, 5 th, and 7 th handwritten, others printed: [Origin.], [ clavus HS. ], [Col. Staudinger | K. 669], [Coll. H.—Sch.] (a large X is penciled across “—” on this label), [917.], [Coll. | Staudinger], [Prot.| Clavus | HS.], [Clavus | H- Sch.], [{QR Code} http://coll.mfn-berlin.de/u/ | 449fc1], [DNA sample ID: | NVG-15036D06 | c/o Nick V. Grishin ] as the lectotype of Goniloba clavus Herrich-Schäffer, 1869 . The 2 nd and 7 th labels are likely written by Plötz and Staudinger, respectively. The lectotype is missing the tornal section of its left hindwing and has a deep tear from the middle of the right forewing outer margin. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website ( Warren et al. 2024). Genomic sequencing places the lectotype among specimens from Southeast and South Brazil ( Fig. 152 View Fig ), suggesting that the type locality of G. clavus is in this region. The COI barcode sequence of the lectotype, sample NVG-15036D06, GenBank PV550065, 658 base pairs, is: AACTCTATATTTTATTTTTGGTATCTGAGCAGGATTATTAGGAACTTCTTTAAGTATATTAATTCGAACAGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACA ATTGTAACAGCTCATGCCTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGGGGATTTGGTAACTGATTAGTACCTTTAATGTTAGGAGCTCCTGATATAGCTTTTCCTCGAA TAAATAATATAAGATTCTGAATATTACCCCCATCATTAGTCTTGCTAATTTCAAGAAGAATTGTAGAAACTGGAGCAGGAACTGGTTGAACTGTTTACCCCCCTCTTTCTTCCAATATTGC TCATCAAGGAGCTTCGGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACTACAATCATTAATATACGTGTAAGAAATTTATTA TTTGATCAAATACCTTTATTTATTTGATCTGTAGGAATTACAGCCCTCTTATTACTTTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATCTTAATACTT CTTTTTTTGACCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
To stabilize nomenclature and define the name Goniloba corope Herrich-Schäffer, 1869 (type locality not specified) objectively, N. V. G. hereby designates a syntype in the MFNB collection, a male illustrated in Fig. 148a View Fig (genitalia Fig. 149a–d View Fig ) that bears the following eight rectangular labels (1 st red, 2 nd purple, others white; 4 th and 6 th handwritten, others printed with handwritten text shown in italics): [Lectotypus], [Origin. | Corope | HS.], [Coll. H.—Sch.], [Proteid. | corope | HS.], [Coll. | Staudinger], [Corope | H-Sch.], [{QR Code} http://coll.mfn-berlin.de/u/ | 3226a4], [DNA sample ID: | NVG-15035 A 04 | c/o Nick V. Grishin ] as the lectotype of Goniloba corope Herrich-Schäffer, 1869 . Handwriting on the 2 nd and 4 th labels matches that of Staudinger. The lectotype is missing half of its left antenna, its right wings are set farther apart from each other than the left wings, and both forewings have tears at the outer margin. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website ( Warren et al. 2024). Genomic sequencing places the lectotype among specimens from Suriname ( Fig. 152 View Fig ), suggesting that the type locality of G. corope is in the Amazonian region, likely in Suriname.
To stabilize nomenclature and define the name Hesperia crataea Hewitson, 1876 (type locality in Brazil: Bahia) objectively, N. V. G. hereby designates a syntype in the BMNH collection, a male that bears the following four labels (1 st round with a red circle, others rectangular; 2 nd red, others white; 3 rd handwritten by Hewitson, 2 nd contains no text, others printed with handwritten text shown in italics): (Type) with ( H | 2335) handwritten on the other side of this label, [], [crataea], [Bahia. | Hewitson Coll. | 79—69. | Hesperia | crataea . 1.] as the lectotype of Hesperia crataea Hewitson, 1876 . The lectotype is missing its abdomen, has some damage along the outer margin of the right hindwing towards the tornus, and is pinned on a short pin inserted into a holder pinned on a regular pin. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website ( Warren et al. 2024).
To stabilize nomenclature and define the name Proteides cervus Möschler, 1877 (type locality in Suriname) objectively, N. V. G. hereby designates a syntype in the MFNB collection, a female that bears the following eight rectangular labels (1st purple, 2nd and 3rd green, others white; 2nd, 3rd, and 5th handwritten, others printed): [Origin.], [ Surinam. | Bgdl. | L. 74.], | [Type. | Verhdlg. d. zool. bot. | Gsllschft. Wien. | XXVI. T.IV.17.p.333.], [Coll. Möschl.], [Cervus | Möschl], [Coll. | Staudinger], [{QR Code} http://coll.mfn-berlin.de/u/ | 44a014], [DNA sample ID: | NVG-15036 F 09 | c/o Nick V. Grishin ] as the lectotype of Proteides cervus Möschler, 1877 . The lectotype is missing its antennae, the end of the abdomen, and the apex of the right hindwing, which was repaired and the middle section glued on, leaving a gap in the middle. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website ( Warren et al. 2024). The type locality of P. cervus (as given on the label) is Suriname: Brokopondo District, Berg en Dal (abbreviated as “Bgdl.”). The COI barcode sequence of the lectotype, sample NVG-15036 F 09, GenBank PV550066, 658 base pairs, is: AACTTTATATTTTATTTTTGGTATATGAGCAGGATTGTTAGGAACTTCATTAAGTATATTAATTCGAACAGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACA ATTGTTACAGCTCATGCCTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGTGCTCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGGATACTACCCCCATCCTTAATCTTATTAATTTCAAGAAGAATCGTAGAAACTGGAGCAGGAACTGGTTGAACTGTTTATCCCCCTCTTTCCTCCAATATCGC TCACCAAGGAGCTTCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACTACAATCATTAATATACGAGTAAGAAACTTATCC TTTGATCAAATACCATTATTTATTTGATCAGTAGGAATTACAGCTCTCTTATTACTTTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATCTTAATACTT CTTTTTTCGATCCAGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT
To stabilize nomenclature and define the name Proteides ampyx Mabille, 1891 (type locality in Panama: Chiriquí) objectively, N. V. G. hereby designates a syntype in the MFNB collection, a male that bears the following eight rectangular labels (1 st purple, others white; 2 nd, 3 rd, 4 th, and 6 th handwritten, others printed): [Origin.], [Chiriqui | Tr.], [Pr. Ampyx | Mb], [Proteid. | Ampyx | Mab.], [Coll. | Staudinger], [Ampÿx | Mab.], [{QR Code} http://coll.mfn-berlin.de/u/ | 449fc0], [DNA sample ID: | NVG-15036D05 | c/o Nick V. Grishin ] as the lectotype of Proteides ampyx Mabille, 1891 . According to its 2nd label, the lectotype was collected in Panama: Chiriquí by Troetsch. The 3rd and the 4th labels are likely written by Mabille and Staudinger, respectively. The lectotype has scales rubbed off at the base of the right hindwing beneath, which was re-attached, and two angular bends in its left antenna. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website ( Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG-15036D05, GenBank PV550067, 658 base pairs, is: AACTTTATATTTTATTTTCGGTATATGAGCAGGATTATTAGGAACTTCCTTAAGTATATTAATTCGAACAGAATTAGGAAATCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACA ATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAACTGATTAGTACCTTTAATATTAGGTGCTCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGGATACTACCCCCATCCTTAATCTTATTAATTTCAAGAAGAATCGTAGAAACTGGAGCAGGAACTGGTTGAACTGTTTACCCCCCCCTTTCATCCAATATTGC TCACCAAGGAGCTTCAGTAGATTTAGCTATTTTTTCTCTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATCAATTTTATTACCACAATTATTAATATACGAGTAAGAAATTTATCC TTTGATCAAATACCATTATTTATTTGATCCGTAGGAATTACAGCTCTCTTATTACTTTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAACCTTAATACTT CTTTTTTTGACCCAGCTGGTGGAGGAGATCCTATTTTATACCAACATTTATTT
To stabilize nomenclature, to define the name Thracides polles Godman, 1901 (type locality in Nicaragua, Panama, and Brazil) objectively, and narrow down the type locality, N. V. G. hereby designates a syntype in the MFNB collection, a female that according to its label was figured on the plate 105 in the original publication (Godman 1901) and bears the following nine rectangular labels (1st purple, others white; 4th handwritten, others printed): [Origin.], [Chiriqui], [811.], [P. b. 159:12.], [Coll. | Staudinger], [Sp. figured], [ B. C. A.Lep.Rhop. | Thracides | polles, | Godm.], [{QR Code} http://coll. mfn-berlin.de/u/ | 440fc9], [DNA sample ID: | NVG-15036 E 01 | c/o Nick V. Grishin ] as the lectotype of Thracides polles Godman, 1901 . The lectotype is missing the left antenna and has two small tears at the outer margins of the left hindwing along CuA2 vein and the right forewing in the cell CuA1-CuA2, but otherwise is a specimen in excellent condition. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website ( Warren et al. 2024). As a result of the lectotype designation, the type locality of T. polles becomes Panama: Chiriquí. The COI barcode sequence of the lectotype, sample NVG-15036 E 01, GenBank PV550068, 658 base pairs, is: AACTTTATATTTTATTTTTGGTGTATGAGCAGGATTATTAGGAACTTCCTTAAGTATACTAATTCGAACAGAATTAGGAAATCCTGGATCTTTAATTGGAGACGATCAAATTTATAATACA ATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAACTGATTAGTACCTTTAATATTAGGTGCTCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGGATACTACCCCCATCCTTAATCTTATTAATTTCAAGAAGAATCGTAGAAACTGGAGCAGGAACTGGTTGAACTGTTTACCCCCCCCTTTCATCCAATATTGC CCACCAAGGGGCTTCAGTAGATTTAGCTATTTTTTCTCTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATCAATTTTATTACCACAATTATTAATATACGAGTAAAAAATTTATCC TTTGATCAAATACCATTATTTATTTGATCCGTAGGAATTACAGCTCTCTTATTACTTTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAACCTTAATACTT CTTTTTTTGATCCAGCTGGCGGAGGAGATCCTATTTTATATCAACATTTATTT
V |
Royal British Columbia Museum - Herbarium |
G |
Conservatoire et Jardin botaniques de la Ville de Genève |
MFNB |
Museo Friulano di Storia Naturale |
H |
University of Helsinki |
ID |
University of Idaho |
B |
Botanischer Garten und Botanisches Museum Berlin-Dahlem, Zentraleinrichtung der Freien Universitaet |
COI |
University of Coimbra Botany Department |
A |
Harvard University - Arnold Arboretum |
T |
Tavera, Department of Geology and Geophysics |
F |
Field Museum of Natural History, Botany Department |
C |
University of Copenhagen |
E |
Royal Botanic Garden Edinburgh |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
SubFamily |
Hesperiinae |
Tribe |
Hesperiini |
Genus |
|
SubGenus |
Ochluma |