Talides hispina Grishin, 2025

Talides hispina Grishin , new species

http://zoobank.org/ C5A26964-A1F4-4601-98D1-1A3FC7583319

( Figs. 145 View Fig part, 146–147)

Definition and diagnosis. Genomic analysis of Talides Hübner, 1819 (type species Talides sinois Hübner, 1819 ) reveals a specimen from Ecuador sister to Talides hispa Evans, 1955 (type locality Panama: Bugaba) that is genetically differentiated from it at the species level ( Fig. 145 View Fig ); e.g., their COI barcodes differ by 2.9% (19 bp). Therefore, this specimen represents a new species. This new species keys to “ Talides alternata hispa ” (K.13.3(b)) in in Evans (1955) but differs from its relatives by a combination of the following characters: the harpe is nearly straight at the dorsal margin and the process of the tegumen is nearly reaching the end of the uncus; the hindwing is less rounded, with orange fringes; two subapical hyaline spots on forewing closest to the costa are dot-like much smaller than the third spot (about a quarter of its size) and are offset basad from it. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly728.7.2:C312G, aly728.7.2:A316C, aly577. 59.7:T621C, aly2633.1.7:T471A, aly2633.1.7:A486T, aly127.44.3:C1029C (not T), aly318.28.4:C189C (not T), aly4506.4.2:A66A (not G), aly 2627.2.5:G60G (not A), aly5719.4.7:C84C (not A); and COI barcode: T205C, T250T, C282T, T386C, C467A, 574C.

Barcode sequence of the holotype. Sample NVG-23069C01, GenBank PV550063, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCTCTAAGATTATTAATTCGAACAGAATTAGGTAACCCAGGATTTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCACGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCCCTTATACTTGGAGCTCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTCTGAATGCTTCCCCCCTCTTTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGTACTGGATGAACTGTATACCCCCCCCTTTCAGCAAATATTGC CCACCAAGGTTCTTCTGTTGATCTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCCTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATAAAAATTAAAAATTTATTA TTTGATCAAATACCCTTATTTGTATGATCTGTAGGAATTACAGCTTTATTATTATTACTATCTTTACCTGTTTTAGCAGGAGCTATTACCATACTTCTTACAGATCGTAATTTAAATACTT CATTTTTTGATCCTGCAGGTGGAGGAGACCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the Texas A&M University Insect Collection, College Station, TX, USA ( TAMU), illustrated in Fig. 146 View Fig (genitalia Fig. 147 View Fig ), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ ECUADOR: Napo Prov. | Misahualli (Lodge & vic.) | 1.03381°S, 77.66191°W | VII-5-10-2010, C.M.Riley], [DNA sample ID: | NVG-23069C01 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-24015D06 | c/o Nick V. Grishin ], [genitalia: | NVG241114-01 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Talides | hispina Grishin] GoogleMaps . The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the tip of the abdomen prior to genitalia dissection.

Type locality. Ecuador: Napo Province, vicinity of Misahualli Lodge   GoogleMaps , GPS −1.03381, −77.66191.

Etymology. The name is formed from its sister species, T. hispa , which is made longer to indicate a more southern distribution of the new species. The name is a noun in apposition.

Distribution. Currently known only from the holotype collected in northern Ecuador.

Comment. Genitalic harpes have black stains, a sign of possible damage during or right after eclosion.