Vacerra cuza Grishin

Vacerra cuza Grishin , new species

http://zoobank.org/ 5BFDC6C4-DAA3-446D-B9DF-E2BA2D270F56

( Figs. 134 View Fig part, 139–140)

Definition and diagnosis. Genomic sequencing of a specimen from Cuzco, Peru, identified as “ Vacerra hermesia cecropterus ” reveals that it is not monophyletic with the lectotype of Vacerra cecropterus (Draudt, 1923) , stat. rest. (type locality in Bolivia: Rio Zongo, sequenced as NVG-18093D10) and is instead sister to Vacerra hermesia (Hewitson, 1870) (type locality in Ecuador), being genetically differentiated from them at the species level ( Fig. 134 View Fig ); e.g., their COI barcodes differ by 2.0% (13 bp) (from its sister V. hermesia ) and 1.5% (10 bp) (from a more distant relative V. cecropterus ). Therefore, the Peruvian specimens represent a new species. This new species keys to “ Vacerra hermesia cecropterus ” (O.8.7.(b)) in Evans (1955) but differs from its relatives by a combination of the following characters: green dorsal overscaling typically subdued, does not strongly stand out and is more olivebrown (not prominently blue-green as in V. hermesia ); the hyaline spot in the forewing cell CuA 1 -CuA 2 being more rounded and strongly separated from the discal cell spot by a brown ground color area and offset distad from it; a small but prominent cream-colored spot in the discal cell of the ventral hindwing; traces of postdiscal cream-colored spots in ventral hindwing cells CuA 1 -CuA 2 and CuA 2 -1A+2A and at the base of cell Sc+R 1 -RS; and a size comparable to V. cecropterus and smaller than V. hermesia . Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly6841.81.1:T529A, aly6841.81.1:C564T, aly84.83.1:G822A, aly36444.1.1:G117A, aly36444.1.1:C141T, aly1603.41.2:A72A (not C), aly16812.3. 4:C81C (not T), aly16812.3.4:G174G (not T), aly164.16.14:G66G (not C), aly164.16.14:C195C (not T); and COI barcode: T19C, T121C, T250C, T361T, T385C, T436C.

Barcode sequence of the holotype. Sample NVG-18128C01, GenBank PV550061, 658 base pairs: AACTTTATATTTTATTTTCGGTATTTGAGCAGGAATACTAGGAACTTCACTAAGACTTTTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAGACGATCAAATTTATAATACC ATTGTCACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATCGGAGGATTTGGAAATTGATTAGTTCCTCTTATATTAGGAGCTCCAGATATAGCTTTCCCACGAA TAAATAACATAAGATTTTGAATATTACCCCCATCATTAACATTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGAACCGGTTGAACTGTTTATCCACCTTTATCTTCAAATATTGC CCATCAAGGAGCTTCTGTTGACTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCTTCTATTTTAGGAGCCATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCT TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCAATTACCATATTACTCACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ currently deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 139 View Fig (genitalia Fig. 140 View Fig ), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ Peru: Cuzco Dept, 1375m | Cosñipata Valley, San Pedro | 13° 03' S, 71° 33' W | November 3, 2017 | Leg: W. Dempwolf], [ Vacerra hermesia | cecropterus | ♂ | Coll of: W R Dempwolf], [DNA sample ID: | NVG-18128C01 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-24015G02 | c/o Nick V. Grishin ], [genitalia: | NVG241114-46 | c/o Nick V. Grishin ], [ WRD 14,869], and one red [HOLOTYPE ♂ | Vacerra cuza | Grishin ]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection.

Type locality. Peru: Cuzco Region, Cosñipata Valley , San Pedro, elevation 1375 m, GPS −13.05, −71.55.

Etymology. The name is formed from the name of the Peruvian region with the type locality and is treated as a feminine noun in apposition.

Distribution. Currently known only from the holotype collected in Cuzco, Peru.