Cetonana shaanxiensis Jin, Yin & Zhang, 2017

Cetonana shaanxiensis Jin, Yin & Zhang, 2017 View in CoL ( Figs 1–4 View FIGURE1 View FIGURE 2 View FIGURE 3 View FIGURE 4 )

Cetonana shaanxiensis Jin, Yin & Zhang, 2017: 231 View in CoL , figs 4A – G, 5A – D

Material examined. CHINA: Gansu Province: 1♂ 1♀ (MHBU-ARA-853-1–2), Longnan City, Wen County, Chengguan Town 33.006°N, 104.707°E, 1722.7 m a.s.l., 25.VIII.2024, leg. K. Yu & H. Zhang GoogleMaps ; 4 ♂ 5♀ (MHBU-ARA-854-1–9), Longnan City, Wen County, Tianchi Town 33.244°N, 104.741°E, 1704.7 m a.s.l., 26.VIII.2024, leg. K. Yu & H. Zhang. GoogleMaps

Diagnosis. The male of this species is similar to the European type species, C. laticeps (Canestrini, 1868) , in having a similarly shaped cymbium and tegulum ( Jin et al. 2017: 230, figs 3A–D) but can be distinguished by: 1) the tegulum being longer than wide (vs. length and width subequal in C. laticeps ); 2) the tegulum being approximately 2/3 the length of cymbium (vs. approximately 1/3 the length of cymbium in C. laticeps ); 3) tegular apophysis non-curved (vs. distally curved dorsally in C. laticeps ); 4) the embolus being approximately half the length of the tegulum (vs. slender, almost twice the length of the tegulum in C. laticeps ). For diagnosis of the female see Jin et al. (2017).

Description. Male (MHBU-ARA-854-1, Fig. 1 View FIGURE1 ). Measurements: total length 5.79; carapace 2.79 long, 2.38 wide; abdomen 3.15 long, 1.89 wide; clypeus height 0.10; labium 0.56 long, 0.54 wide; sternum 1.54 long, 1.25 wide, CRW 1.53. Eye diameters and interdistances: AME 0.21, ALE 0.15, PME 0.14, PLE 0.15; AME–AME 0.08, AME–ALE 0.07, ALE–ALE 0.53, PME–PME 0.20, PME–PLE 0.11, PLE–PLE 0.79, ALE–PLE 0.11, OAW 1.02. Leg measurements: Ⅰ 7.70 (2.30, 0.89, 1.92, 1.52, 1.07), II 7.68 (2.17, 0.98, 1.84, 1.63, 1.06), III 5.75 (1.66, 0.55, 1.34, 1.51, 0.69), IV 7.92 (2.18, 0.73, 2.00, 2.13, 0.88); leg formula: 4123.

Chelicerae ( Fig. 1C View FIGURE1 ) brown, with cheliceral boss at ectal base, with three promarginal and one retromarginal teeth. Endites orange-brown, longer than wide, with dark serrula. Labium brown, apex lighter in color, length and width subequal. Sternum brown, with darker edges, shield-shaped, with precoxal triangles and intercoxal extensions present.

Legs brown, tibiae, metatarsi, and tarsi dorsally with sparse tactile hairs; femora darker, legs I–II stouter. Tibiae I proventrally with one cusp, metatarsi I–II and tarsi I–II ventrally with two lines of cusps ( Fig. 1E–F View FIGURE1 ), tarsi III–IV ventrally with distal preening brush ( Fig. 1D View FIGURE1 ).

Abdomen subfusiform, dorsally with light brown leathery scutum, with darker stripes and two pairs of brown cardiac patterns, grey laterally; ventrally brown to pale-yellow, with two lines of sclerotized spots.

Palp ( Fig. 2 View FIGURE 2 ): Cymbium brown with blunt pale-yellow apex; embolus flagelliform, slightly curved; tegulum approximately triangular, light-brown, prolateral apex with one relatively large apophysis, sperm duct visible in dorsal view; tibia brown, retrolateral tibial apophysis dorsally curved and sharply pointed.

Female (MHBU-ARA-854-5, Fig. 3 View FIGURE 3 ). Measurements: Total length 6.76; carapace 2.86 long, 2.37 wide; abdomen 3.97 long, 2.82 wide; clypeus height 0.10; labium 0.46 long, 0.44 wide; sternum 1.56 long, 1.29 wide CRW 1.53. Diameters and interdistances of eyes: AME 0.17, ALE 0.16, PME 0.13, PLE 0.12; AME–AME 0.07, AME–ALE 0.05, ALE–ALE 0.50, PME–PME 0.23, PME–PLE 0.15, PLE–PLE 0.78, ALE–PLE 0.09, OAW 0.99. Leg measurements: Ⅰ 7.42 (2.17, 0.93, 1.86, 1.50, 0.96), II 7.32 (2.18, 0.88, 1.75, 1.54, 0.97), III 5.70 (1.64, 0.64, 1.29, 1.46, 0.67), IV 7.83 (2.26, 0.75, 1.92, 2.12, 0.78); leg formula: 4123.

Chelicerae with three promarginal and two retromarginal teeth. Abdomen pale-yellow, sclerotized spots grey. Other characters as in male.

Epigyne and vulva ( Fig. 4 View FIGURE 4 ): Hood present anteriorly, with one longitudinal depression approximately half the length of ST2 and with two longitudinal sclerotized stripes medially; atrium indistinct; copulatory openings small, originating posteriorly; CD V-shaped, looping dorsally and connecting with ventral median part of ST1; curved CnD extending from median part of ST1, looping dorsally and connecting to posterior part of ST2; ST2 large, kidney-shaped. For schematic structure of internal duct system see fig. 5E in Jin et al. (2017).

Distribution. China ( Gansu, Shaanxi).

DNA barcodes. COI (5’–3’):

MHBU-ARA-854- 1 ♂ (GenBank accession number: PX369912): AAAGATATTGGAACTTTATATTTGATTTTTGGA

GCTTGATCTGCTATAGTAGGAACGGCTATGAGTGTTTTAATTCGGATGGAATTAGGACAATCAGGAAGATTGTTAGG

GGATGATCATTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCTATTTTAA

TTGGTGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGGGCTCCGGATATAGCTTTTCCTCGAATGAATAATTTA

AGTTTTTGATTATTACCTCCTTCTTTGATATTATTATTTGTATCTTCTATAGCTGAAATAGGTGTGGGAGCAGGTTG

AACAGTTTACCCCCCTTTGGCTTCAAATATAGGACATTCTGGATTTGCTATAGATTTTGCTATTTTTTCTTTACATT

TAGCAGGTGCTTCTTCTATTATAGGGGCTGTTAATTTTATTTCTACTATCATTAATATACGATCTGTTGGAATAAGA

ATAGAGAGGGTTCCTTTGTTTGTTTGGTCAGTTTTTATTACTGCTATTTTATTATTATTATCTTTACCTGTTTTAGC

AGGTGCTATTACTATGCTGTTGACGGATCGTAATTTTAATACATCATTTTTTGATCCGGCTGGAGGAGGGGATCCTA

TTTTATTTCAACATCTATTTTGATTTTTT

MHBU-ARA-854- 5 ♀ (GenBank accession number: PX369913): CATAAAGATATTGGAACTTTATATTTGATTTT

TGGAGCTTGATCTGCTATAGTAGGAACGGCTATGAGTGTTTTAATTCGGATGGAATTAGGACAATCAGGAAGATTGT

TAGGGGATGATCATTTGTATAATGTTATTGTAACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCTATT

TTAATTGGTGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGGGCTCCGGATATAGCTTTTCCTCGAATGAATAA

TTTAAGTTTTTGATTATTACCTCCTTCTTTGATATTATTATTTGTATCTTCTATAGCTGAAATAGGTGTGGGAGCAG

GTTGAACAGTTTACCCCCCTTTGGCTTCAAATATAGGACATTCTGGATTTGCTATAGATTTTGCTATTTTTTCTTTA

CATTTAGCAGGTGCTTCTTCTATTATAGGGGCTGTTAATTTTATTTCTACTATCATTAATATACGATCTGTTGGAAT

AAGAATAGAGAGGGTTCCTTTGTTTGTTTGGTCAGTTTTTATTACTGCTATTTTATTATTATTATCTTTACCTGTTT

TAGCAGGTGCTATTACTATGCTGTTGACGGATCGTAATTTTAATACATCATTTTTTGATYCGGCTGGAGGAGGGGAT

CCTATTTTATTTCAACATCTATTTTGATTTTTTGGTC

Remarks. The conspecificity of the male and female specimens can be further confirmed by a genetic distance of 0.00% between two specimens ( ♂ ♀) collected and sequenced from the same location.

The number of cusps on the left legs of all specimens was examined ( Table 1), with the exception of one specimen missing the left legs I and II, for which the right legs were inspected instead. When our cusp count data are combined with those of C. laticeps from Jin et al. (2017), it reveals that the number of cusps is not a reliable diagnostic character within the genus Cetonana Strand, 1929 .