Langduoa dianae Tedersoo, 2024

Tedersoo, Leho, Magurno, Franco, Alkahtani, Saad & Mikryukov, Vladimir, 2024, Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes), MycoKeys 107, pp. 249-271 : 249-271

publication ID

https://doi.org/10.3897/mycokeys.107.125549

DOI

https://doi.org/10.5281/zenodo.13286514

persistent identifier

https://treatment.plazi.org/id/540EE31A-230A-5EA2-B48A-7CBFA29997CF

treatment provided by

MycoKeys by Pensoft

scientific name

Langduoa dianae Tedersoo
status

sp. nov.

Langduoa dianae Tedersoo sp. nov.

Diagnosis.

Separation from other species of Langduoa based on the ITS region (positions 87–106 actgagccttgcagcaacaatctccccttt; no mismatch allowed) and LSU (positions 617–636 ccctctcggggggctgggga; no mismatch allowed) as indicated in Fig. 8 View Figure 8 .

Type.

Soil eDNA sample TUE 128827 (holotype); eDNA sequence: EUK 1107335 (lectotype); montane grassland in Langduo , Tibet, 29.4 ° N, 94.4 ° E GoogleMaps .

Description.

Other sequences: EUK 1602727 and EUK 1602728 (both from GSMc plot G 5906, stadium grassland soil in Karksi-Nuia, Estonia, 58.10088 ° N, 25.55959 ° E); EUK 1604031 (GSMc plot G 4185, Picea - Pinus forest soil in Ristipalo, Estonia, 58.10241 ° N, 27.47874 ° E); and EUK 1604032 (GSMc plot G 4766, soil of coppiced garden dominated by Fraxinus and Ulmus in Ruudiküla, Estonia, 58.33630 ° N, 25.78084 ° E).

Etymology.

Langduo (Tibetan) refers to type locality; and Diana (Lithuanian) refers to the first name of Diana Marčiulynienė who was the first to record this genus.

Notes.

Found from grassland soils in Estonia and Tibet, with ITS and LSU sequences differing up to 0.2 %. So far, not found from the roots.