Eresus kollari Rossi, 1846

Eresus kollari Rossi, 1846 View in CoL

Materials

Type status: Other material. Occurrence: catalogNumber: TTQXIV 0000000231 ; recordedBy: Sue Yeon Lee, Chang Moon Jang & Seung Tae Kim; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: C264EF20-34D2-53D6-8DF4-10166AE878FE; Taxon: scientificName: Eresus kollari ; kingdom: Animalia; phylum: Arthropoda; class: Arachnida; order: Araneae ; family: Eresidae ; Location: country: South Korea; stateProvince: Gangwon State; municipality: Jeongseon-gun; locality: Nampyeong-ri, Bukpyeong-myeon ; verbatimElevation: 366 m; verbatimCoordinates: 37°26'21.8"N 128°39'51.0"E; Identification: identifiedBy: Seung Tae Kim; Event: samplingProtocol: hand collecting; eventDate: 03-10-2023; habitat: grassy grave; Record Level: institutionCode: National Institute of Biological resources ( NIBR) GoogleMaps

Type status: Other material. Occurrence: catalogNumber: KKU-Ere- 20231003-01 ; recordedBy: Sue Yeon Lee, Chang Moon Jang & Seung Tae Kim; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 095BD786-A8E0-5F50-BA85-9B2C99801B92; Taxon: scientificName: Eresus kollari ; kingdom: Animalia; phylum: Arthropoda; class: Arachnida; order: Araneae ; family: Eresidae ; Location: country: South Korea; stateProvince: Gangwon State; municipality: Jeongseon-gun; locality: Nampyeong-ri, Bukpyeong-myeon ; verbatimElevation: 366 m; verbatimCoordinates: 37°26'21.8"N 128°39'51.0"E; Identification: identifiedBy: Seung Tae Kim; Event: samplingProtocol: hand collecting; eventDate: 03-10-2023; habitat: grassy grave; Record Level: institutionCode: Konkuk University ( KKU) GoogleMaps

Type status: Other material. Occurrence: catalogNumber: TTQXIV 0000000232 ; recordedBy: Sue Yeon Lee, Chang Moon Jang & Seung Tae Kim; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 4F7E3E76-C42A-5070-B15B-DE6E5F28D561; Taxon: scientificName: Eresus kollari ; kingdom: Animalia; phylum: Arthropoda; class: Arachnida; order: Araneae ; family: Eresidae ; Location: country: South Korea; stateProvince: Gangwon State; municipality: Jeongseon-gun; locality: Nampyeong-ri, Bukpyeong-myeon ; verbatimElevation: 366 m; verbatimCoordinates: 37°26'21.8"N 128°39'51.0"E; Identification: identifiedBy: Seung Tae Kim; Event: samplingProtocol: hand collecting; eventDate: 08-05-2024; habitat: grassy grave; Record Level: institutionCode: National Institute of Biological resources ( NIBR) GoogleMaps

Type status: Other material. Occurrence: catalogNumber: KKU-Ere- 20230508-01 ; recordedBy: Sue Yeon Lee, Chang Moon Jang & Seung Tae Kim; individualCount: 2; sex: female; lifeStage: adult; occurrenceID: F333E982-0AEC-52E3-8A4C-EF4D596C4409; Taxon: scientificName: Eresus kollari ; kingdom: Animalia; phylum: Arthropoda; class: Arachnida; order: Araneae ; family: Eresidae ; Location: country: South Korea; stateProvince: Gangwon State; municipality: Jeongseon-gun; locality: Nampyeong-ri, Bukpyeong-myeon ; verbatimElevation: 366 m; verbatimCoordinates: 37°26'21.8"N 128°39'51.0"E; Identification: identifiedBy: Seung Tae Kim; Event: samplingProtocol: hand collecting; eventDate: 08-05-2024; habitat: grassy grave; Record Level: institutionCode: Konkuk University ( KKU) GoogleMaps

Type status: Other material. Occurrence: catalogNumber: KKU-Ere- 20231003-02 ; recordedBy: Sue Yeon Lee, Chang Moon Jang & Seung Tae Kim; individualCount: 2; sex: female; lifeStage: adult; occurrenceID: 2A109105-44ED-5CC2-9EDC-A273EED14A09; Taxon: scientificName: Eresus kollari ; kingdom: Animalia; phylum: Arthropoda; class: Arachnida; order: Araneae ; family: Eresidae ; Location: country: South Korea; stateProvince: Gangwon State; municipality: Pyeongchang-gun; locality: Jongbu-ri, Pyeongchang-eup ; verbatimElevation: 391 m; verbatimCoordinates: 37°21'42.8"N 128°23'44.8"E; Identification: identifiedBy: Seung Tae Kim; Event: samplingProtocol: hand collecting; eventDate: 03-10-2023; habitat: grassy grave; Record Level: institutionCode: Konkuk University ( KKU) GoogleMaps

Description

Male. Habitus as in Fig. 4 View Figure 4 A – C. Total length 8.23. Carapace: 3.78 long / 2.72 wide / 2.00 high. Eyes: AER 0.68, PER 2.16. Endite: 1.10 long / 0.60 wide. Labium: 0.85 long / 0.60 wide. Sternum: 2.13 long / 1.39 wide. Legs: I 7.95 (2.34, 1.29, 1.38, 1.51, 1.43), II 6.63 (1.95, 1.10, 1.22, 1.18, 1.18), III 5.68 (1.73, 1.10, 0.97, 1.01, 0.90), IV 8.19 (2.65, 1.36, 1.60, 1.50, 1.08). Palp: 3.06 (1.23, 0.55, 0.22, -, 1.06). Abdomen: 4.20 long / 3.38 wide.

Carapace black, rectangular, longer than wide; head region elevated, covered densely with black and white setae; thoracic region covered with black and white setae, posterior part dark orange; AER <PER (Fig. 4 View Figure 4 A and C). Chelicerae stout, black, covered with black setae (Fig. 4 View Figure 4 A – C). Endite black, slightly curved, anterior edge blunt (Fig. 4 View Figure 4 B). Sternum dark orange mottled with black, narrow, much longer than wide, covered densely with black and white setae, anterior edge truncated (Fig. 4 View Figure 4 B). Legs thick and strongly developed, covered densely with black, white and orange setae; Legs I and II mostly black, femur II dark orange, joints orange with white annuli; legs III and IV turbid orange mottled with black, joints with white annuli; leg formula IV-I-II-III (Fig. 4 View Figure 4 A – C). Abdomen ivory, with four black, round spots, anterior part protruding above the thoracic region (Fig. 4 View Figure 4 A and C). Palpus (Fig. 4 View Figure 4 I – K): tegulum round; embolus rotating clockwise along the top of the tegulum; conductor sclerotised, wider than long, with a prominent shoulder; terminal tooth sclerotised, straight; groove small, V-shaped; lamella translucent with a feather-like edge, slightly longer than terminal tooth.

Female. Habitus as in Fig. 4 View Figure 4 D – F. Total length 12.89. Carapace: 6.11 long / 4.24 wide / 3.07 high. Eyes: AER 0.87, PER 3.09. Endite: 1.71 long / 0.97 wide. Labium: 1.29 long / 0.96 wide. Sternum: 3.28 long / 2.01 wide. Legs: I 10.15 (3.04, 1.74, 1.74, 1.99, 1.64), II 9.08 (2.81, 1.65, 1.53, 1.51, 1.58), III 8.17 (2.79, 1.70, 1.32, 1.21, 1.15), IV 10.83 (3.69, 1.99, 2.01, 1.91, 1.23). Palp: 4.45 (1.54, 0.94, 0.62, -, 1.35). Abdomen: 6.52 long / 6.20 wide. Epigynum: 1.35 wide.

Carapace blackish-brown, rectangular, longer than wide, covered densely with black and white setae; head region elevated; AER <PER (Fig. 4 View Figure 4 D and F). Chelicerae stout, blackish-brown, covered with black and white setae (Fig. 4 View Figure 4 D – F). Endite blackish-brown, straight, anterior edge angular, truncated (Fig. 4 View Figure 4 E). Sternum blackish-brown, medially black, narrow, much longer than wide, anterior edge truncated, covered densely with black setae (Fig. 4 View Figure 4 E). Legs thick and strongly developed, covered densely with black setae; blackish-brown, joints with white annuli; leg formula IV-I-II-III (Fig. 4 View Figure 4 D – F). Abdomen blackish-brown, with four pairs of muscle impressions, dorsum gently sloped, anterior part protruding above the thoracic region (Fig. 4 View Figure 4 D and F). Epigyne (Fig. 4 View Figure 4 G): elliptical with a sclerotised margin, anterior bar wide, slightly depressed, wider than long, fissure anteriorly incurvated, almost longitudinal. Internal genitalia (Fig. 3 H): copulatory ducts large, translucent, anterior section elliptical, far from each other; spermathecae distinctly lobated, extended laterally to the copulatory ducts.

Habitat

This species is frequently found inhabiting tombs at hilly gravesites in South Korea (Fig. 2 View Figure 2 A and B). The spider builds a silken tunnel, about 15–20 cm in length, underground in the yellow soil between grasses, such as fine-leaf shae sedges ( Carex humilis var. nana Ohwi ) ( Cyperaceae ) and zoysia grass ( Zoysia japonica Steud ) ( Poaceae ) (Fig. 2 View Figure 2 C). A sheet web is attached above the entrance of the silken tube, which is connected to the ground (Fig. 2 View Figure 2 D and E).

Distribution

Europe, Turkey, Caucasus, Iran, China, South Korea, Russia (to Far East), Central Asia ( World Spider Catalog 2025).

DNA Barcodes

JS 1

AAAATCAAAATAAATGTTGAAATAAAATAGGATCTCCTCCCCCAGCAGGATCAAAAAACGATGTATTAAAATTTCGATCAGTTAATAATATTGTAATAGCACCCGCTAAAACAGGTAAAGATAACAACAATAATACCGCAGTAATTAAAACAGATCAAACAAATAATGATACCTTCTCCATTGTTATTCCATATGAACGTATATTAATTACAGTTGTAATAAAATTAATAGCCCCCATAATAGAAGAAGCCCCAGCTAAATGTAATGAAAAAATAGCAAAATCTACTGATCTCCCCGCATGACCTATTAATGACGTTAAAGGAGGATAAACAGTTCACCCTGTCCCTACACCCATTTCTACTATAGAAGACATAAATAATATAAACAATGAAGGAGGTAATAACCAAAAACTTAAATTATTTATTCGAGGAAAAGCTATATCAGGTGCCCCTAATATTAAAGGAACCAATCAATTCCCAAACCCTCCAATTATAATTGGTATAACTATAAAAAAAATTATAACAAAAGCATGAGCAGTAACAATAACATTATATAAATGATCATCTCCTAATAATCTCCCAGATTGTCCTAATTCCGTTCGAATAATTATTCTTATTGAAGTTCCAACTATAGCTGATCAAGCTCCAAAAATTAAATACAACGTTCCAA (GenBank accession number PV 785314)

JS 2

AAAATCAAAATAAATGTTGAAATAAAATAGGATCTCCTCCCCCAGCAGGATCAAAAAACGATGTATTAAAATTTCGATCAGTTAATAATATTGTAATAGCACCCGCTAAAACAGGTAAAGATAACAACAATAATACCGCAGTAATTAAAACAGATCAAACAAATAATGATACCTTCTCCATTGTTATTCCATATGAACGTATATTAATTACAGTTGTAATAAAATTAATAGCCCCCATAATAGAAGAAGCCCCAGCTAAATGTAATGAAAAAATAGCAAAATCTACTGATCTCCCCGCATGACCTATTAATGACGCTAAAGGAGGATAAACAGTTCACCCTGTCCCTACACCCATTTCTACTATAGAAGACATAAATAATATAAACAATGAAGGAGGTAATAACCAAAAACTTAAATTATTTATTCGAGGAAAAGCTATATCAGGTGCCCCTAATATTAAAGGAACCAATCAATTCCCAAACCCTCCAATTATAATTGGTATAACTATAAAAAAAATTATAACAAAAGCATGAGCAGTAACAATAACATTATATAAATGATCATCTCCTAATAATCTCCCAGATTGTCCTAATTCCGTTCGAATAATTATTCTTATTGAAGTTCCAACTATAGCTGATCAAGCTCCAAAAATTAAATACAACGTTCCAA (GenBank accession number PV 785315)

JS 3

AAAATCAAAATAAATGTTGAAATAAAATAGGATCTCCTCCCCCAGCAGGATCAAAAAACGATGTATTAAAATTTCGATCAGTTAATAATATTGTAATAGCACCCGCTAAAACAGGTAAAGATAACAACAATAATACCGCAGTAATTAAAACAGATCAAACAAATAATGATACCTTCTCCATTGTTATTCCATATGAACGTATATTAATTACAGTTGTAATAAAATTAATAGCCCCCATAATAGAAGAAGCCCCAGCTAAATGTAATGAAAAAATAGCAAAATCTACTGATCTCCCCGCATGACCTATTAATGACGTTAAAGGAGGATAAACAGTTCACCCTGTCCCTACACCCATTTCTACTATAGAAGACATAAATAATATAAACAATGAAGGAGGTAATAACCAAAAACTTAAATTATTTATTCGAGGAAAAGCTATATCAGGTGCCCCTAATATTAAAGGAACCAATCAATTCCCAAACCCTCCAATTATAATTGGTATAACTATAAAAAAAATTATAACAAAAGCATGAGCAGTAACAATAACATTATATAAATGATCATCTCCTAATAATCTCCCAGATTGTCCTAATTCCGTTCGAATAATTATTCTTATTGAAGTTCCAACTATAGCTGATCAAGCTCCAAAAATTAAATACAACGTTCCAA (GenBank accession number PV 785316)

PC 1

AAAATCAAAATAAATGTTGAAATAAAATAGGATCTCCTCCCCCAGCAGGATCAAAAAACGATGTATTAAAATTTCGATCAGTTAATAATATTGTAATAGCACCCGCTAAAACAGGTAAAGATAACAACAATAATACCGCAGTAATTAAAACAGATCAAACAAATAATGATACCTTCTCCATTGTTATTCCATATGAACGTATATTAATTACAGTTGTAATAAAATTAATAGCCCCCATAATAGAAGAAGCCCCAGCTAAATGTAATGAAAAAATAGCAAAATCTACTGATCTCCCCGCATGACCTATTAATGACGCTAAAGGAGGATAAACAGTTCACCCTGTCCCTACACCCATTTCTACTATAGAAGACATAAATAATATAAACAATGAAGGAGGTAATAACCAAAAACTTAAATTATTTATTCGAGGAAAAGCTATATCAGGTGCCCCTAATATTAAAGGAACCAATCAATTCCCAAACCCTCCAATTATAATTGGTATAACTATAAAAAAAATTATAACAAAAGCATGAGCAGTAACAATAACATTATATAAATGATCATCTCCTAATAATCTCCCAGATTGTCCTAATTCCGTTCGAATAATTATTCTTATTGAAGTTCCAACTATAGCTGATCAAGCTCCAAAAATTAAATACAACGTTCCAA (GenBank accession number PV 785317)

PC 2

AAATCAAAATAAATGTTGAAATAAAATAGGATCTCCTCCCCCAGCAGGATCAAAAAACGATGTATTAAAATTTCGATCAGTTAATAATATTGTAATAGCACCCGCTAAAACAGGTAAAGATAACAACAATAATACCGCAGTAATTAAAACAGATCAAACAAATAATGATACCTTCTCCATTGTTATTCCATATGAACGTATATTAATTACAGTTGTAATAAAATTAATAGCCCCCATAATAGAAGAAGCCCCAGCTAAATGTAATGAAAAAATAGCAAAATCTACTGATCTCCCCGCATGACCTATTAATGACGCTAAAGGAGGATAAACAGTTCACCCTGTCCCTACACCCATTTCTACTATAGAAGACATAAATAATATAAACAATGAAGGAGGTAATAACCAAAAACTTAAATTATTTATTCGAGGAAAAGCTATATCAGGTGCCCCTAATATTAAAGGAACCAATCAATTCCCAAACCCTCCAATTATAATTGGTATAACTATAAAAAAAATTATAACAAAAGCATGAGCAGTAACAATAACATTATATAAATGATCATCTCCTAATAATCTCCCAGATTGTCCTAATTCCGTTCGAATAATTATTCTTATTGAAGTTCCAACTATAGCTGATCAAGCTCCAAAAATTAAATACAACGTTCCAA (GenBank accession number PV 785318)