Zeuzera, Latreille, 1804
publication ID |
https://doi.org/10.37828/em.2024.77.20 |
persistent identifier |
https://treatment.plazi.org/id/7464474A-F211-ED70-0EF6-46A8FB140A6F |
treatment provided by |
Felipe |
scientific name |
Zeuzera |
status |
|
Collection of Zeuzera View in CoL larvae from the field and laboratory rearing
Thirty branches of Glyptostrobus pensilis and thirty plants each of Coffea arabica and Passiflora edulis , all with two to five feeding holes in the stems, were harvested in Ea Ho ward, Krong Nang district and Ea Ral ward, Ea H’Leo district, Dak Lak province in February 2024. Stems with holes were cut into 0.8 m lengths, placed inside cardboard boxes, and transported to the Forest Protection Research Centre (FPRC) in Hanoi, Vietnam where the stems were cut open and the Zeuzera larvae removed. The larvae were reared in a laboratory (28.0 oC ± 0.2; 75.0% ± 0.3 RH) and fed with compound diets comprising food plant material until pupation.
To prepare the food material, stems ( 2–3 cm diameter, 50 cm length) of 3-year-old G. pensilis , C. arabica and P. edulis plants were collected from Dak Lak province and the fresh stems were ground (Makita LS1030N) into powders. The diet composition was modified from diets developed by Wu et al. (2017) and Pham et al. (2023). Each kg of the 3 artificial diets contained 241.6 g plant powder, 48.4 g agar, 64.4 g glucose, 16.2 g cellulose, 40.2 g yeast extract, 96.6 g rye flour, 6.4 g sodium benzoate, 3.2 g sorbic acid, and 483 ml distilled water. The mixtures were placed in 1.5 L pots, mixed with a magnetic stirrer on a hot plate for 3 minutes, and partitioned into 50 ml round-bottomed polypropylene bottles, which were capped with silicon stoppers. Ten holes ( 0.5 mm in diameter) were made in the cap surface to allow the exchange of air during laboratory rearing. The containers were autoclaved at 121 oC, 15 PSI for 20 minutes and allowed to cool before use. One larva was added to each bottle.
Identification
Characterization and identification of 30 adult specimens was based on keys in Arora (1976) and Yakovlev (2014), and the specimens were deposited in the insect collection of the FPRC, Hanoi, Vietnam.
To confirm the identification, the mitochondrial cytochrome oxidase 1 gene region was sequenced using mtDNA extracted from the legs of three adult specimens FPRC151 (from G. pensilis ), FPRC154 (from C. arabica ), and FPRC155 (from P. edulis ) collected in Dak Lak province. The primers COI-LEP-F (ATTCAACCAATCATAAAGATATTGG) and COI-LEP-R (TAAACTTCTGGATGTCCAAAAAATCA) ( Hajibabaei et al. 2006) were used. Protocols were performed as described by Zahiri et al. (2010), Sutrisno (2015) and Yakovlev et al. (2020). A phylogram was obtained using the Maximum Likelihood method ( Kumar et al. 2016).
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.